ࡱ > } ~ o@ < bjbj
p
p y" o o 6 L " " " " " " " $ F D D D P E G $ F = V >H 4 rN " N N N oO . O O $ R r A " D] oO oO D] D] " " N N D] ) " N " N D] ( " " N 2H X Nf D
0 = W ܊ W F F " " " " W " h O . S V d KY O O O F $ j + n/ D n F j n/ ORIGINAL ARTICLE
Brain insulin system dysfunction in streptozotocin intracerebroventricularly treated rats generates hyperphosphorylated tau protein
Grnblatt Edna1(, Salkovic-Petrisic Melita2, Jelena Osmanovic2, Riederer Peter1, Hoyer Siegfried3
1 Institute of Clinical Neurochemistry and National Parkinson Foundation Centre of Excellence Laboratory, Clinic for Psychiatry and Psychotherapy, Bayrische Julius-Maximilian-University of Wrzburg, Wrzburg, Germany.
2 Department of Pharmacology and Croatian Institute for Brain Research, Medical School, University of Zagreb, Zagreb, Croatia
3 Department of Pathology, University of Heidelberg, Heidelberg, Germany.
Running title: Alzheimers disease is an insulin resistant brain state
Keywords: Alzheimers disease, Brain, Gene expression, GLUT2, Insulin, Insulin receptor, Learning / Memory, Protein tyrosine kinase, Streptozotocin, Tau protein.
Word No. Abstract: 200 Word No. Text: 6628 No. Figures: 4
No. Tables: 5 Suppl. Material: 0
Submission date: DATE \@ "dddd, dd MMMM yyyy" \* MERGEFORMAT Thursday, 15 March 2007
( All correspondence to Dr. Edna Grnblatt:
Bayerische Julius-Maximilians- University Wrzburg
Clinic and Policlinic for Psychiatry and Psychotherapy / Neurochemistry Laboratory
Fchsleinstr. 15
D-97080 Wrzburg / Germany
Tel: +49-931-20177300
Fax: +49-931-20177220
E-mail: HYPERLINK "mailto:edna.gruenblatt@mail.uni-wuerzburg.de" edna.gruenblatt@mail.uni-wuerzburg.de
Abstract
The intracerebroventricular (icv) application of streptozotocin (STZ) in low dosage was used in 3-month-old rats to explore brain insulin system dysfunction. Three months following STZ-icv treatment, the expression of insulin-1 and -2 mRNA was significantly reduced to 11% in hippocampus and to 28% in frontoparietal cerebral cortex, respectively. Insulin receptor (IR) mRNA expression decreased significantly in frontoparietal cerebral cortex and hippocampus (16% and 33% of control). At the protein/activity level, different abnormalities of protein tyrosine kinase activity (increase in hippocampus), total IR (-subunit (decrease in hypothalamus), and phosphorylated IR tyrosine residues (increase) became apparent. The STZ-induced disturbance in learning and memory capacities was not abolished by icv application of glucose transport inhibitors known to prevent STZ induced diabetes mellitus. The discrepancy between reduced IR gene expression and increase in both phosphorylated IR tyrosine residues / protein tyrosine kinase activity may indicate imbalance between phosphorylation/dephosphorylation of the IR (-subunit causing its dysfunction. These abnormalities may point to a complex brain insulin system dysfunction after STZ-icv application which may lead to an increase in hyperphosphorylated tau-protein concentration. Brain insulin system dysfunction is discussed as possible pathological core in the generation of hyperphosphorylated tau protein as a morphological marker of sporadic Alzheimers disease.
Introduction
Substantial evidence has been gathered in support of the presence of both insulin and insulin receptors in the brain. The main source of brain insulin is pancreatic beta cells. Insulin is known to cross the blood brain barrier (BBB) by a saturation transport mechanism. The transporter is unevenly distributed throughout the brain, with the olfactory bulb having the fastest transport rate of any brain region ADDIN EN.CITE Banks200456100150940690014-29994901-32004Apr 19The source of cerebral insulin5-12Research Service (151), GRECC, Veterans Affairs Medical Center-St. Louis and Saint Louis University School of Medicine, Division of Geriatrics, Department of Internal Medicine, WAB, 915 N. Grand Boulevard, St. Louis, MO 63106, USA. bankswa@slu.eduBanks, W. A.Eur J PharmacolAnimalsBiological TransportBlood-Brain Barrier/metabolismCentral Nervous System/blood supply/ metabolismHumansInsulin/ metabolism(Banks 2004), demonstrating, in addition, regional differences in transport kinetics. A smaller proportion of insulin is produced in the brain itself ADDIN EN.CITE Plata-Salaman19915611018523150149-76341521991SummerInsulin in the cerebrospinal fluid243-58School of Life and Health Sciences, University of Delaware, Newark 19716.Plata-Salaman, C. R.Neurosci Biobehav RevAnimalsHumansInsulin/ cerebrospinal fluid/physiology(Plata-Salaman 1991). Insulin gene expression and insulin synthesis have been demonstrated in both immature and mature mammalian neuronal cells ADDIN EN.CITE Schechter19925619014824420006-899358211992Jun 5Developmental regulation of insulin in the mammalian central nervous system27-37St. Francis Hospital of Tulsa Medical Research Institute, OK.Schechter, R.Whitmire, J.Holtzclaw, L.George, M.Harlow, R.Devaskar, S. U.Brain ResAging/ metabolismAnimalsBlotting, NorthernBrain/embryology/growth & development/ metabolismElectrophoresis, Polyacrylamide GelEmbryonic and Fetal DevelopmentEnzyme-Linked Immunosorbent AssayFetusGestational AgeInsulin/cerebrospinal fluid/genetics/ metabolismInsulin-Like Growth Factor I/ metabolismInsulin-Like Growth Factor II/ metabolismRNA, Messenger/analysis/metabolismRabbitsResearch Support, Non-U.S. Gov'tResearch Support, U.S. Gov't, P.H.S.Schechter19965616089303040006-89937361-21996Oct 14Preproinsulin I and II mRNAs and insulin electron microscopic immunoreaction are present within the rat fetal nervous system16-27William K. Warren Medical Research Institute, University of Oklahoma Health Sciences Center, Tulsa 74136-7862, USA.Schechter, R.Beju, D.Gaffney, T.Schaefer, F.Whetsell, L.Brain ResAnimalsBase SequenceBrain/ embryology/metabolism/ultrastructureCloning, MolecularDNA PrimersEmbryonic and Fetal DevelopmentFetusGanglia, Spinal/ embryology/metabolism/ultrastructureGestational AgeInsulin/analysis/ biosynthesisIslets of Langerhans/embryology/metabolism/ultrastructureMicroscopy, ImmunoelectronMolecular Sequence DataOrgan SpecificityPolymerase Chain ReactionProinsulin/analysis/ biosynthesisProtein Precursors/analysis/ biosynthesisRNA, Messenger/biosynthesisRatsRecombinant Proteins/biosynthesisSpinal Cord/ embryology/metabolism/ultrastructureSchechter200156130112870630165-380612712001Mar 29Neuronal synthesized insulin roles on neural differentiation within fetal rat neuron cell cultures41-9William K. Warren Medical Research Institute, University of Oklahoma Health Sciences Center, Suite 1010, 6465 S. Yale Ave., 74136, Tulsa, OK, USA. rxschechter@saintfrancis.com.Schechter, R.Abboud, M.Brain Res Dev Brain ResAnimalsAntibodies/pharmacologyBrain/cytologyCell CountCell Differentiation/drug effects/physiologyCells, CulturedFetus/cytology/metabolism/secretionInsulin/ biosynthesis/immunology/secretionInsulin-Like Growth Factor I/pharmacologyNeurons/ cytology/ metabolism/secretionRatsRats, Sprague-DawleyResearch Support, Non-U.S. Gov't(Schechter et al. 1992; Schechter et al. 1996; Schechter and Abboud 2001). Insulin mRNA was found to be distributed in a highly specific pattern with the highest density in pyramidal cells of the hippocampus and high densities in medial prefrontal cortex, the entorhinal and perihinal cortices, the thalamus and the granule layer of the olfactory bulb, as well as in hypothalamus. Neither insulin mRNA nor synthesis of the hormone were observed in glial cells ADDIN EN.CITE Devaskar19945621081325710021-9258269111994Mar 18Insulin gene expression and insulin synthesis in mammalian neuronal cells8445-54Department of Pediatrics, St. Louis University School of Medicine, Missouri.Devaskar, S. U.Giddings, S. J.Rajakumar, P. A.Carnaghi, L. R.Menon, R. K.Zahm, D. S.J Biol ChemAging/metabolismAmino Acid SequenceAnimalsBase SequenceBrain/growth & development/ metabolismCell Nucleus/metabolismCells, CulturedGene ExpressionInsulin/ biosynthesis/ geneticsIslets of Langerhans/metabolismMolecular Sequence DataNeuroglia/metabolismNeurons/ metabolismPolymerase Chain ReactionRNA, Messenger/analysis/ biosynthesisRabbitsRatsRats, Sprague-DawleyResearch Support, U.S. Gov't, Non-P.H.S.Research Support, U.S. Gov't, P.H.S.Transcription, Genetic(Devaskar et al. 1994). The release of insulin from brain synaptosomes is stimulated by glucose ADDIN EN.CITE Santos19995622099732340364-31902411999JanStimulation of immunoreactive insulin release by glucose in rat brain synaptosomes33-6Center for Neurosciences of Coimbra, Department of Zoology, University of Coimbra, Portugal.Santos, M. S.Pereira, E. M.Carvaho, A. P.Neurochem ResAnimalsBrain/ physiologyGlucose/metabolism/ pharmacologyGlycolysis/drug effectsInsulin/ secretionIodoacetic Acid/pharmacologyKineticsMaleOligomycins/pharmacologyPotassium Cyanide/pharmacologyRadioimmunoassayRatsRats, WistarResearch Support, Non-U.S. Gov'tSynaptosomes/drug effects/metabolism/ secretion(Santos et al. 1999).
It has been demonstrated that insulin receptors are dispersed throughout the brain and also follow a highly specific pattern with the highest density detected in olfactory bulb, hypothalamus, cerebral cortex and hippocampus ADDIN EN.CITE van Houten1979562302238290013-722710531979SepInsulin-binding sites in the rat brain: in vivo localization to the circumventricular organs by quantitative radioautography666-73van Houten, M.Posner, B. I.Kopriwa, B. M.Brawer, J. R.EndocrinologyAnimalsBinding, CompetitiveBrain ChemistryCorticotropin/pharmacologyHypothalamo-Hypophyseal System/ analysisHypothalamus/ analysisInsulin/analogs & derivatives/metabolismMaleMedian Eminence/ analysisProinsulin/pharmacologyProlactin/pharmacologyRatsReceptor, Insulin/ analysisResearch Support, U.S. Gov't, P.H.S.Subfornical Organ/analysisUnger19895625027710550306-45223111989Distribution of insulin receptor-like immunoreactivity in the rat forebrain143-57Department of Neurology, University of Rochester School of Medicine and Dentistry, NY 14642.Unger, J.McNeill, T. H.Moxley, R. T., 3rdWhite, M.Moss, A.Livingston, J. N.NeuroscienceAnimalsBrain MappingFrontal Lobe/cytology/ metabolismImmunohistochemistryMaleRatsRats, Inbred StrainsReceptor, Insulin/ metabolismResearch Support, Non-U.S. Gov'tResearch Support, U.S. Gov't, P.H.S.(van Houten et al. 1979; Unger et al. 1989). Nerve terminals show enriched densities of insulin receptors ADDIN EN.CITE van Houten19805624069866520036-807520744351980Mar 7Insulin binding sites localized to nerve terminals in rat median eminence and arcuate nucleus1081-3van Houten, M.Posner, B. I.Kopriwa, B. M.Brawer, J. R.ScienceAnimalsAutoradiographyAxons/metabolismHypothalamo-Hypophyseal System/ metabolismHypothalamus/blood supply/cytology/ metabolismInsulin/blood/ metabolismMedian Eminence/ metabolismMicrocirculationNerve Endings/metabolismRatsReceptor, Insulin/ metabolismResearch Support, U.S. Gov't, P.H.S.Synapses/metabolismAbbott199956260104602361529-240119171999Sep 1The insulin receptor tyrosine kinase substrate p58/53 and the insulin receptor are components of CNS synapses7300-8Department of Neuroscience, Brown University, Providence, Rhode Island 02912, USA.Abbott, M. A.Wells, D. G.Fallon, J. R.J NeurosciAmino Acid SequenceAnimalsBrain/cytology/ physiologyBrain ChemistryCells, CulturedCerebellum/chemistry/cytology/physiologyElectrophoresis, Gel, Two-DimensionalHippocampus/chemistry/cytology/physiologyMolecular Sequence DataNerve Tissue Proteins/ analysis/chemistry/geneticsNeurons/chemistry/ physiologyPhosphoproteins/ analysis/chemistry/geneticsRatsReceptor, Insulin/ analysis/genetics/ metabolismResearch Support, Non-U.S. Gov'tResearch Support, U.S. Gov't, P.H.S.Reverse Transcriptase Polymerase Chain ReactionSpectrometry, Mass, Matrix-Assisted Laser Desorption-IonizationSynapses/chemistry/ physiologySynaptosomes/chemistry(van Houten et al. 1980; Abbott et al. 1999) which bind insulin in a highly specific and rapid manner ADDIN EN.CITE Raizada19885627032929650364-31901341988AprInsulin receptors in the brain: structural and physiological characterization297-303Department of Physiology, University of Florida College of Medicine, Gainesville 32610.Raizada, M. K.Shemer, J.Judkins, J. H.Clarke, D. W.Masters, B. A.LeRoith, D.Neurochem ResAnimalsBrain/ metabolismCell Membrane/metabolismInsulin/pharmacologyKineticsLiver/metabolismMacromolecular SubstancesMolecular WeightNorepinephrine/metabolismRatsRats, Inbred StrainsReceptor, Insulin/isolation & purification/ metabolismResearch Support, Non-U.S. Gov'tResearch Support, U.S. Gov't, P.H.S.Sodium/pharmacologySynaptosomes/drug effects/ metabolism(Raizada et al. 1988). Two different types of insulin receptors have been found in the adult mammalian brain: a peripheral type on glial cells ((-subunit 130kDa, (-subunit 95 kDa) which is down-regulated by insulin, and a neuron-specific brain type with high concentration on neurons ((-subunit 118kDa, (-subunit 91 kDa) which is not down-regulated by insulin ADDIN EN.CITE Adamo19895628025530690893-764831-21989Spring-SummerInsulin and insulin-like growth factor receptors in the nervous system71-100Section of Molecular and Cellular Physiology, NIDDK, Bethesda, MD 20892.Adamo, M.Raizada, M. K.LeRoith, D.Mol NeurobiolAnimalsBrain/cytology/growth & developmentBrain ChemistryInsulin/analysis/physiologyReceptor, Insulin/analysis/physiologyReceptors, Cell Surface/analysis/physiologyReceptors, SomatomedinResearch Support, Non-U.S. Gov'tSomatomedins/analysis/physiology(Adamo et al. 1989). The location of phosphotyrosine-containing proteins corresponds to the distribution of the insulin receptor ADDIN EN.CITE Moss19905629016937700027-842487121990JunLocation of phosphotyrosine-containing proteins by immunocytochemistry in the rat forebrain corresponds to the distribution of the insulin receptor4453-7Department of Medicine, University of Rochester School of Medicine, NY 14642.Moss, A. M.Unger, J. W.Moxley, R. T.Livingston, J. N.Proc Natl Acad Sci U S AAnimalsBrain/anatomy & histology/ cytologyBrain ChemistryImmune SeraMaleNerve Tissue Proteins/ analysisOrgan SpecificityPhosphoproteins/ analysisPhosphotyrosineRatsRats, Inbred StrainsReceptor, Insulin/ analysisResearch Support, Non-U.S. Gov'tResearch Support, U.S. Gov't, P.H.S.Tyrosine/ analogs & derivatives/analysis(Moss et al. 1990). Insulin receptor mRNA is abundantly present in neuronal somata ADDIN EN.CITE Schwartz19925313014254821331992AugInsulin in the brain: a hormonal regulator of energy balance387-414Department of Medicine, University of Washington, Seattle.Schwartz, M. W.Figlewicz, D. P.Baskin, D. G.Woods, S. C.Porte, D., Jr.Endocr RevAnimalsBrain/blood supply/ physiologyEating/physiologyEnergy IntakeEnergy Metabolism/ physiologyHumanHypothalamus/physiologyInsulin/blood/cerebrospinal fluid/ physiologyReceptor, Insulin/physiologySupport, Non-U.S. Gov'tSupport, U.S. Gov't, Non-P.H.S.Support, U.S. Gov't, P.H.S.(Schwartz et al. 1992) but the protein shows the highest density in the synaptic neuropil ADDIN EN.CITE Baskin19945630075110940013-722713441994AprInsulin receptor substrate-1 (IRS-1) expression in rat brain1952-5Veterans Affairs Medical Center, Seattle, WA 98108.Baskin, D. G.Schwartz, M. W.Sipols, A. J.D'Alessio, D. A.Goldstein, B. J.White, M. F.EndocrinologyAnimalsBrain/cytology/ metabolismHippocampus/cytology/metabolismImmunohistochemistryIn Situ HybridizationMaleNeurons/metabolismOlfactory Bulb/cytology/metabolismPhosphoproteins/genetics/ metabolismPhosphotyrosineRNA, Messenger/metabolismRatsRats, WistarResearch Support, U.S. Gov't, Non-P.H.S.Research Support, U.S. Gov't, P.H.S.Tyrosine/analogs & derivatives/metabolism(Baskin et al. 1994). Besides these brain-related data, detailed effects of insulin on its peripheral receptor in adipocytes and muscle cells were summarized in several review articles, as presented below. Binding of insulin to the extracellular (-subunit of its receptor induces autophosphorylation of the intracellular (-subunit by phosphorylation of the intrinsic tyrosine residues 1158, 1162 and 1163 for activation ADDIN EN.CITE Combettes-Souverain19985664099322141262-3636 (Print)2461998DecMolecular basis of insulin action477-89Laboratoire de Physiologie de la Nutrition, Universite d'Orsay, France.Combettes-Souverain, M.Issad, T.Diabetes Metab1-Phosphatidylinositol 3-Kinase/metabolismCa(2+)-Calmodulin Dependent Protein Kinase/metabolismCell Differentiation/physiologyCell Division/physiologyEnzyme ActivationHumansInsulin/ metabolismReceptor, Insulin/ metabolismSignal Transduction/physiology(Combettes-Souverain and Issad 1998). The receptors activation state is regulated by its phosphorylation state. Deactivation may be induced by the action of both phosphotryosine phosphatase causing dephosphorylation ADDIN EN.CITE Goldstein19935665083941711052-8040 (Print)311993SpringRegulation of insulin receptor signaling by protein-tyrosine dephosphorylation1-15Dorrance H. Hamilton Research Laboratories, Department of Medicine, Jefferson Medical College, Thomas Jefferson University, Philadelphia, PA 19107.Goldstein, B. J.ReceptorProtein-Tyrosine Kinase/metabolismProtein-Tyrosine-Phosphatase/ metabolismReceptor, Insulin/ metabolismResearch Support, U.S. Gov't, P.H.S.Signal Transduction(Goldstein 1993) and by serine/threonine kinases causing phosphorylation at serine residues 1305 and 1306, and threonine residue 1348 ADDIN EN.CITE Häring199156660Häring, H. U.1991The insulin receptor: signalling mechanism and contribution to the pathogenesis of insulin resistanceDiabetologia3412848-61Dec0012-186X (Print)1663881AnimalsDiabetes Mellitus, Experimental/physiopathologyDiabetes Mellitus, Type 2/ physiopathologyHumansInsulin ResistanceMacromolecular SubstancesModels, BiologicalProtein-Tyrosine Kinase/metabolismReceptor, Insulin/genetics/ physiologySignal TransductionInstitute for Diabetes Research, Munich, FRG.Avruch19985667096091120300-8177 (Print)1821-21998MayInsulin signal transduction through protein kinase cascades31-48Department of Molecular Biology, Massachusetts General Hospital, Boston, MA 02114, USA.Avruch, J.Mol Cell BiochemAnimalsHumansInsulin/metabolism/ physiologyModels, BiologicalProtein-Serine-Threonine Kinases/ metabolism/physiologySignal Transduction/ physiology(Hring 1991; Avruch 1998). Interestingly, the activity of protein tyrosine phosphatase was found to be regulated by insulin ADDIN EN.CITE Kenner19935668082449790021-9258 (Print)268341993Dec 5Regulation of protein tyrosine phosphatases by insulin and insulin-like growth factor I25455-62Department of Medicine, University of California, San Diego, La Jolla 92093.Kenner, K. A.Hill, D. E.Olefsky, J. M.Kusari, J.J Biol ChemAmino Acid SequenceAnimalsCell LineDose-Response Relationship, DrugGene Expression Regulation, Enzymologic/drug effectsImmunoblottingInsulin/metabolism/ pharmacologyInsulin-Like Growth Factor I/ pharmacologyKineticsMolecular Sequence DataMuscles/drug effects/ enzymologyPeptides/metabolismProtein-Tyrosine-Phosphatase/biosynthesis/isolation &purification/ metabolismRNA, Messenger/biosynthesisRatsReceptor, Insulin/metabolismResearch Support, Non-U.S. Gov'tResearch Support, U.S. Gov't, Non-P.H.S.Research Support, U.S. Gov't, P.H.S.Subcellular Fractions/enzymologyTranscription, Genetic/drug effects(Kenner et al. 1993). Thus, as a general phenomenon insulin receptor signaling dysfunction may be caused when tyrosine phosphorylation, and/or when tyrosine dephosphorylation fails, and/or when serine/threonine phosphorylation is increased and maintained at a higher level.
Evidence has been provided that the neuronal glucose metabolism is pre-eminent for neuronal/brain function. Under normal conditions, this metabolic pathway is the only source of ATP, and contributes to the formation of acetylcholine, cholesterol and neurosteroids via the metabolite acetyl CoA, and to UDP-N-glucosamine via the metabolite fructose-6-phosphate. It may be assumed that the neuronal glucose metabolism is under control of the neuronal insulin signal transduction system (for review ADDIN EN.CITE Hoyer200656697Hoyer, S.Frölich, L2006Brain function and insulin signal transduction in sporadic Alzheimer's diseaseSun, M.K.Research Progress in Alzheimer's Disease and DementiaNew YorkNova ScienceIn Press(Hoyer and Frlich 2006). Through this mediate the insulin signal may effect on neurotrophic and neuromodulatory functions, synaptic plasticity, and learning and memory capacities ADDIN EN.CITE Zhao199939660Brain insulin receptors and spatial memory. Correlated changes in gene expression, tyrosine phosphorylation, and signaling molecules in the hippocampus of water maze trained ratsZhao, W.Chen, H.Xu, H.Moore, E.Meiri, N.Quon, M. J.Alkon, D. L.3T3 CellsAnimalBrain/drug effects/*metabolism/*physiologyCalcium/pharmacologyCerebral Cortex/metabolismGene Expression RegulationHippocampus/drug effects/metabolismIntramolecular Transferases/metabolismMAP Kinase Signaling SystemMaleMaze Learning*MemoryMiceMolecular Sequence DataPhosphorylation/drug effectsProteins/metabolismRNA, Messenger/metabolismRatsRats, WistarReceptor, IGF Type 1/metabolismReceptor, Insulin/genetics/*metabolismSignal Transduction/drug effectsSpatial BehaviorTime FactorsTyrosine/metabolismJ Biol Chem19992744934893-902.Park200039490Intracerebroventricular insulin enhances memory in a passive-avoidance taskPark, C. R.Seeley, R. J.Craft, S.Woods, S. C.AnimalAvoidance Learning/*drug effectsElectroshockHypoglycemic Agents/administration & dosage/*pharmacologyInjections, IntraventricularInsulin/administration & dosage/*pharmacologyMaleMemory/*drug effectsRatsRats, Long-EvansSupport, U.S. Gov't, P.H.S.Physiol Behav2000684509-14.(Zhao et al. 1999; Park et al. 2000). Predominant abnormalities in cerebral glucose metabolism and its control by the neuronal insulin signal transduction system have been found in sporadic Alzheimers disease (SAD) ADDIN EN.CITE Frölich199853450Frölich, L.Blum-Degen, D.Bernstein, H. G.Engelsberger, S.Humrich, J.Laufer, S.Muschner, D.Thalheimer, A.Turk, A.Hoyer, S.Zochling, R.Boissl, K. W.Jellinger, K.Riederer, P.1998Brain insulin and insulin receptors in aging and sporadic Alzheimer's diseaseJ Neural Transm1054-5423-38.AdultAge FactorsAgedAged, 80 and overAging/*physiologyAlzheimer Disease/*metabolismBrain/growth & development/*metabolism/physiologyC-Peptide/metabolismFrontal Lobe/metabolismHumanInsulin/*metabolismMiddle AgeNeurons/physiologyOccipital Lobe/metabolismParietal Lobe/metabolismReceptor, Insulin/*metabolismReference ValuesSupport, Non-U.S. Gov'tTemporal Lobe/metabolismHoyer200238310The brain insulin signal transduction system and sporadic (type II) Alzheimer disease: an updateHoyer, S.Age FactorsAlzheimer Disease/*etiology/genetics/*metabolismBrain/*metabolism/physiopathologyDiabetes Mellitus,Non-Insulin-Dependent/*complications/genetics/*metabolismEnergy Metabolism/*geneticsGenetic Predisposition to DiseaseGlucose/metabolismHumanInsulin/genetics/*metabolismInsulysin/genetics/metabolismPotassium Channels/genetics/metabolismReceptor, Insulin/genetics/*metabolismReceptors, Drug/genetics/metabolismJ Neural Transm20021093341-60.Hoyer200453620Glucose metabolism and insulin receptor signal transduction in Alzheimer diseaseHoyer, S.Eur J Pharmacol20044901-3115-25.Hoyer19919320Predominant abnormality in cerebral glucose utilization in late-onset dementia of the Alzheimer type: a cross-sectional comparison against advanced late-onset and incipient early-onset casesHoyer, S.Nitsch, R.Oesterreich, K.AgedAged, 80 and overAlzheimer Disease/*metabolism/physiopathology/psychologyBrain/*metabolismCarbon Dioxide/metabolismCerebrovascular Circulation/*physiologyComparative StudyFemaleGlucose/*metabolismHumanLactates/metabolismMaleMiddle AgeOxygen/metabolismPsychiatric Status Rating ScalesPsychometricsTime FactorsJ Neural Transm Park Dis Dement Sect1991311-14.(Hoyer et al. 1991; Frlich et al. 1998; Hoyer 2002, 2004), putting forward the hypothesis that SAD is the brain type of diabetes mellitus II ADDIN EN.CITE Hoyer19988870Is sporadic Alzheimer disease the brain type of non-insulin dependent diabetes mellitus? A challenging hypothesisHoyer, S.Age of OnsetAlzheimer Disease/etiology/*physiopathologyBrain/*metabolism/physiopathologyDiabetes Mellitus, Non-Insulin-Dependent/complications/*physiopathologyEnergy MetabolismGlucose/metabolismGlycosylation End Products, AdvancedHumanInsulin/physiologyModels, NeurologicalNeurons/*physiologyReceptor, Insulin/physiologySignal TransductionJ Neural Transm19981054-5415-22.(Hoyer 1998). A mismatch of both the insulin action and IR function itself, including downstream signaling pathways has been proposed to be involved in brain insulin system dysfunction in SAD ADDIN EN.CITE Salkovic-Petrisic200556710Salkovic-Petrisic, M.Lackovic, Z.2005Insulin resistant brain state and its link to diabetes mellitus.Period. Biol.107137-146(Salkovic-Petrisic and Lackovic 2005).
Considering the presence of insulin (originating from both periphery and brain) and insulin receptors in the brain, an experimental rat model was developed by using streptozotocin (STZ) to induce the brain insulin system dysfunction. In general, STZ is a drug selectively toxic for insulin producing/secreting cells, as following systemically application STZ enters the cells via the glucose GLUT2 transporter, mainly localized in pancreatic (-cells (to a certain extent also in hepatocytes and absorptive epithelial cells of the intestine and kidney). Coupled with glucokinase, GLUT2 participates in a glucose-sensing mechanism in (-cells important for insulin production/secretion. STZ exerts betacytotoxic effects mostly by causing alkylation of DNA which triggers activation of poly ADP-ribosylation consequently leading to depletion of cellular NAD+ and ATP, and finally to a permanent diabetes mellitus when applied in a higher dosage ADDIN EN.CITE Szkudelski200157920118293140862-8408 (Print)5062001The mechanism of alloxan and streptozotocin action in B cells of the rat pancreas537-46Department of Animal Physiology and Biochemistry, University of Agriculture, Poznan, Poland.Szkudelski, T.Physiol ResAlloxan/ pharmacologyAnimalsAntibiotics, Antineoplastic/ pharmacologyDiabetes Mellitus, Experimental/ chemically induced/metabolismIslets of Langerhans/ drug effects/metabolismRatsStreptozocin/ pharmacology(Szkudelski 2001). In contrast, in moderate to low dosage and in short-term experiments, STZ caused insulin resistance ADDIN EN.CITE Blondel19895672026976070338-1684 (Print)1561989Nov-DecEarly appearance of in vivo insulin resistance in adult streptozotocin-injected rats382-7Laboratoire de Physiologie du Developpement-CNRS URA 307-Universite Paris 7, France.Blondel, O.Portha, B.Diabete MetabAnimalsBlood Glucose/metabolismDiabetes Mellitus, Experimental/ physiopathologyGlucose Clamp TechniqueInsulin/blood/pharmacologyInsulin Infusion SystemsInsulin ResistanceMaleRatsRats, Inbred StrainsReference ValuesResearch Support, Non-U.S. Gov't(Blondel and Portha 1989) by a decreased autophosphorylation of the insulin receptor ADDIN EN.CITE Kadowaki198410310Decreased autophosphorylation of the insulin receptor-kinase in streptozotocin-diabetic ratsKadowaki, T.Kasuga, M.Akanuma, Y.Ezaki, O.Takaku, F.AnimalDiabetes Mellitus, Experimental/*enzymologyImmunosorbent TechniquesInsulin/metabolismLectins/metabolismMaleMolecular WeightPhosphorylationProtein Kinases/*metabolismRatsRats, Inbred StrainsReceptor, InsulinSupport, Non-U.S. Gov'tTime FactorsWheat Germ AgglutininsJ Biol Chem19842592214208-16.(Kadowaki et al. 1984), increased total insulin receptor number but with little change in phosphorylated IR-( subunit one ADDIN EN.CITE Giorgino19925639015316270013-722713031992MarChanges in tyrosine phosphorylation of insulin receptors and a 170,000 molecular weight nonreceptor protein in vivo in skeletal muscle of streptozotocin-induced diabetic rats: effects of insulin and glucose1433-44Research Division, Joslin Diabetes Center, Boston, Massachusetts 02215.Giorgino, F.Chen, J. H.Smith, R. J.EndocrinologyAnimalsBlood Glucose/metabolism/physiologyDiabetes Mellitus, Experimental/ metabolismDose-Response Relationship, DrugGlucose/ pharmacologyImmunoblottingInsulin/ pharmacologyMaleMolecular WeightMuscles/drug effects/ metabolism/ultrastructurePhosphorylation/drug effectsPrecipitin TestsRatsRats, Inbred StrainsReceptor, Insulin/analysis/ metabolismResearch Support, Non-U.S. Gov'tResearch Support, U.S. Gov't, P.H.S.StreptozocinTime FactorsTyrosine/ metabolism(Giorgino et al. 1992), and maintained insulin-immunoreactive cells in the pancreas generating a transient diabetes mellitus ADDIN EN.CITE Rajab19895640025140760168-8227731989Sep 18Islet transplantation to the renal subcapsular space in streptozotocin-diabetic rats: short-term effects on glucose-stimulated insulin secretion197-204Department of Surgery, Lund University, Sweden.Rajab, A. A.Ahren, B.Bengmark, S.Diabetes Res Clin PractAnimalsBlood Glucose/analysisDiabetes Mellitus, Experimental/ surgeryGlucose/pharmacologyInsulin/blood/ secretionIslets of Langerhans TransplantationMaleRatsResearch Support, Non-U.S. Gov'tAr'Rajab199310430Long-term diabetogenic effect of streptozotocin in ratsAr'Rajab, A.Ahren, B.AnimalBlood Glucose/metabolismDiabetes Mellitus, Experimental/*chemicallyinduced/pathology/physiopathologyGlucagon/metabolismInsulin/metabolism/pharmacology/secretionIslets of Langerhans/drug effects/pathology/secretionMaleRatsRats, Sprague-DawleyStreptozocin/administration & dosage/*toxicitySupport, Non-U.S. Gov'tTime FactorsPancreas19938150-7.(Rajab et al. 1989; Ar'Rajab and Ahren 1993). In this study STZ was applied intracerebroventricularly (icv) in a dosage up to 100 times lower (per kg b.w.) than used for systemic application. STZ icv did not cause a systemic diabetes mellitus ADDIN EN.CITE Nitsch19919300Local action of the diabetogenic drug, streptozotocin, on glucose and energy metabolism in rat brain cortexNitsch, R.Hoyer, S.Adenosine Diphosphate/metabolismAdenosine Triphosphate/metabolismAnimalCerebral Cortex/drug effects/*metabolismCitric Acid Cycle/drug effectsEnergy Metabolism/*drug effectsGlucose/*metabolismGlycolysis/drug effectsInjections, IntraventricularLactates/metabolismMalePhosphocreatine/analogs & derivatives/metabolismRatsRats, Inbred StrainsStreptozocin/administration & dosage/*pharmacologySupport, Non-U.S. Gov'tNeurosci Lett19911282199-202.Duelli19948080Intracerebroventricular injection of streptozotocin induces discrete local changes in cerebral glucose utilization in ratsDuelli, R.Schrock, H.Kuschinsky, W.Hoyer, S.AnimalBrain/*metabolismDisease Models, AnimalFrontal Lobe/metabolismGlucose/*metabolismHemodynamicsInjections, SpinalMaleRatsRats, WistarReceptor, Insulin/metabolismStreptozocin/*pharmacologySupport, Non-U.S. Gov'tInt J Dev Neurosci1994128737-43.Lannert19988030Intracerebroventricular administration of streptozotocin causes long-term diminutions in learning and memory abilities and in cerebral energy metabolism in adult ratsLannert, H.Hoyer, S.Adenosine Diphosphate/metabolismAdenosine Triphosphate/metabolismAlzheimer Disease/chemically induced/*physiopathologyAnimalAvoidance Learning/*drug effectsBehavior, Animal/drug effects/*physiologyBlood Glucose/drug effects/metabolismBrain/drug effects/*metabolismDisease Models, AnimalEnergy Metabolism/drug effects/*physiologyHabituation (Psychophysiology)MaleMemory/drug effects/*physiologyPractice (Psychology)RatsRats, WistarReceptor, Insulin/antagonists & inhibitorsStatistics, NonparametricStreptozocin/pharmacologyBehav Neurosci199811251199-208.(Nitsch and Hoyer 1991; Duelli et al. 1994; Lannert and Hoyer 1998). The pancreatic STZ-transporter GLUT2 has also been found in mammalian brain ADDIN EN.CITE Brant199339580Immunological analysis of glucose transporters expressed in different regions of the rat brain and central nervous systemBrant, A. M.Jess, T. J.Milligan, G.Brown, C. M.Gould, G. W.AnimalBrain/*metabolismCell Membrane/metabolismComparative StudyElectrophoresis, Polyacrylamide GelImmunoblottingMembrane Proteins/isolation & purificationMonosaccharide Transport Proteins/analysis/isolation &purification/*metabolismOrgan SpecificityPituitary Gland/*metabolismRatsSupport, Non-U.S. Gov'tBiochem Biophys Res Commun199319231297-302.Leloup19945793081998630006-8993 (Print)6381-21994Feb 28Glucose transporter 2 (GLUT 2): expression in specific brain nuclei221-6Laboratoire de Physiopathologie de la Nutrition, CNRS URA 307, Universite Paris VII, France.Leloup, C.Arluison, M.Lepetit, N.Cartier, N.Marfaing-Jallat, P.Ferre, P.Penicaud, L.Brain ResAnimalsBrain/ metabolismComparative StudyDNA PrimersFemaleGene ExpressionGlucose Transporter Type 2Immunoenzyme TechniquesImmunohistochemistryMedulla Oblongata/cytology/physiologyMicroscopy, ImmunoelectronMonosaccharide Transport Proteins/analysis/ biosynthesisNeurons/ metabolismOrgan SpecificityPolymerase Chain Reaction/methodsPyramidal Tracts/cytology/metabolismRaphe Nuclei/cytology/metabolismRatsRats, WistarSolitary Nucleus/cytology/metabolism/ultrastructureNgarmukos200157940113253410006-8993 (Print)90012001May 4Co-localization of GLUT1 and GLUT4 in the blood-brain barrier of the rat ventromedial hypothalamus1-8Department of Internal Medicine, 5570 MSRB-2, Box 0678, University of Michigan Medical School, Ann Arbor, MI 48109, USA.Ngarmukos, C.Baur, E. L.Kumagai, A. K.Brain ResAnimalsBlood-Brain BarrierCapillaries/chemistryCerebral Ventricles/chemistryComparative StudyFluorescent Antibody Technique, IndirectGlucose/metabolismGlucose Transporter Type 1Glucose Transporter Type 4Insulin/metabolismMaleMonosaccharide Transport Proteins/ analysisMuscle ProteinsMuscle, Skeletal/chemistryOrgan SpecificityRatsRats, Sprague-DawleyResearch Support, Non-U.S. Gov'tResearch Support, U.S. Gov't, P.H.S.Sarcolemma/chemistryVentromedial Hypothalamic Nucleus/blood supply/ chemistry(Brant et al. 1993; Leloup et al. 1994; Ngarmukos et al. 2001). GLUT2 is regionally specifically distributed throughout the rat brain, especially in the limbic areas and related nuclei, most concentrated in the ventral and medial regions close to the midline ADDIN EN.CITE Arluison200457960154828990891-0618 (Print)2832004NovDistribution and anatomical localization of the glucose transporter 2 (GLUT2) in the adult rat brain--an immunohistochemical study117-36Laboratoire de Cytologie, Universite Pierre et Marie Curie (Paris 6), CNRS UMR 7101 (Neurobiologie des Signaux Intercellulaires), 7 quai Saint Bernard, 75252 Paris Cedex 05, France. michel.arluison@snv.jussieu.frArluison, M.Quignon, M.Nguyen, P.Thorens, B.Leloup, C.Penicaud, L.J Chem NeuroanatAnimalsBrain/metabolism/ ultrastructureComparative StudyGlucose Transporter Type 1Glucose Transporter Type 2Glucose Transporter Type 3Glucose Transporter Type 4ImmunohistochemistryMaleMicroscopy, Electron, TransmissionMonosaccharide Transport Proteins/metabolism/ ultrastructureMuscle Proteins/metabolism/ultrastructureNerve Tissue Proteins/metabolism/ultrastructureNeurons/metabolism/ ultrastructureOligodendroglia/metabolism/ultrastructureRatsRats, WistarResearch Support, Non-U.S. Gov'tArluison200457950154829000891-0618 (Print)2832004NovImmunocytochemical localization of the glucose transporter 2 (GLUT2) in the adult rat brain. II. Electron microscopic study137-46Laboratoire de Cytologie, CNRS UMR 7101, Neurobiologie des Signaux Intercellulaires, Universite Pierre et Marie Curie (Paris 6), 7 quai Saint Bernard, 75252 Paris Cedex 05, France. michel.arluison@snv.jussieu.frArluison, M.Quignon, M.Thorens, B.Leloup, C.Penicaud, L.J Chem NeuroanatAnimalsAstrocytes/metabolism/ultrastructureBrain/metabolism/ ultrastructureDendritic Spines/ ultrastructureGlucose Transporter Type 2ImmunohistochemistryMaleMicroscopy, Electron, TransmissionMonosaccharide Transport Proteins/ ultrastructureOligodendroglia/metabolism/ultrastructureRatsResearch Support, Non-U.S. Gov't(Arluison et al. 2004b; Arluison et al. 2004a). Localization of GLUT2 labeling is more numerous in the vicinity of nerve terminals and/or dendrites or dendritic spines forming synaptic contacts, which together with neuronal localization relatively similar to that of glucokinase, support the idea that GLUT2 may be expressed by some cerebral neurons possibly involved in glucose sensing ADDIN EN.CITE Arluison200457960154828990891-0618 (Print)2832004NovDistribution and anatomical localization of the glucose transporter 2 (GLUT2) in the adult rat brain--an immunohistochemical study117-36Laboratoire de Cytologie, Universite Pierre et Marie Curie (Paris 6), CNRS UMR 7101 (Neurobiologie des Signaux Intercellulaires), 7 quai Saint Bernard, 75252 Paris Cedex 05, France. michel.arluison@snv.jussieu.frArluison, M.Quignon, M.Nguyen, P.Thorens, B.Leloup, C.Penicaud, L.J Chem NeuroanatAnimalsBrain/metabolism/ ultrastructureComparative StudyGlucose Transporter Type 1Glucose Transporter Type 2Glucose Transporter Type 3Glucose Transporter Type 4ImmunohistochemistryMaleMicroscopy, Electron, TransmissionMonosaccharide Transport Proteins/metabolism/ ultrastructureMuscle Proteins/metabolism/ultrastructureNerve Tissue Proteins/metabolism/ultrastructureNeurons/metabolism/ ultrastructureOligodendroglia/metabolism/ultrastructureRatsRats, WistarResearch Support, Non-U.S. Gov'tArluison200457950154829000891-0618 (Print)2832004NovImmunocytochemical localization of the glucose transporter 2 (GLUT2) in the adult rat brain. II. Electron microscopic study137-46Laboratoire de Cytologie, CNRS UMR 7101, Neurobiologie des Signaux Intercellulaires, Universite Pierre et Marie Curie (Paris 6), 7 quai Saint Bernard, 75252 Paris Cedex 05, France. michel.arluison@snv.jussieu.frArluison, M.Quignon, M.Thorens, B.Leloup, C.Penicaud, L.J Chem NeuroanatAnimalsAstrocytes/metabolism/ultrastructureBrain/metabolism/ ultrastructureDendritic Spines/ ultrastructureGlucose Transporter Type 2ImmunohistochemistryMaleMicroscopy, Electron, TransmissionMonosaccharide Transport Proteins/ ultrastructureOligodendroglia/metabolism/ultrastructureRatsResearch Support, Non-U.S. Gov't(Arluison et al. 2004b; Arluison et al. 2004a). However, other studies have demonstrated that GLUT2 mRNA distribution in the adult rat brain is not entirely parallel to that of glucokinase at the quantitative level; being lower, similar or higher than glucokinase in different brain regions, respectively ADDIN EN.CITE Li200357980127500160169-328X (Print)1131-22003May 12Distribution of glucokinase, glucose transporter GLUT2, sulfonylurea receptor-1, glucagon-like peptide-1 receptor and neuropeptide Y messenger RNAs in rat brain by quantitative real time RT-PCR139-42Pennington Biomedical Research Center C1038, Louisiana State University, 6400 Perkins Rd, Baton Rouge 70808, USA.Li, B.Xi, X.Roane, D. S.Ryan, D. H.Martin, R. J.Brain Res Mol Brain ResATP-Binding Cassette TransportersAnimalsAppetite Regulation/ geneticsBrain/ metabolismGlucokinase/ geneticsGlucose/metabolismGlucose Transporter Type 2Hypothalamus/metabolismMaleMonosaccharide Transport Proteins/ geneticsNeuropeptide Y/ geneticsPotassium Channels/ geneticsPotassium Channels, Inwardly RectifyingRNA, Messenger/metabolismRatsRats, Inbred StrainsReceptors, Drug/ geneticsReceptors, Glucagon/ geneticsResearch Support, U.S. Gov't, Non-P.H.S.Rhombencephalon/metabolism(Li et al. 2003). This may suggest different roles of particular regions in terms of glucose sensing, but also participation of brain GLUT2 in functions other than glucose sensing, like regulation of neurotransmitter release and perhaps, in the release of glucose by glial cells ADDIN EN.CITE Arluison200457960154828990891-0618 (Print)2832004NovDistribution and anatomical localization of the glucose transporter 2 (GLUT2) in the adult rat brain--an immunohistochemical study117-36Laboratoire de Cytologie, Universite Pierre et Marie Curie (Paris 6), CNRS UMR 7101 (Neurobiologie des Signaux Intercellulaires), 7 quai Saint Bernard, 75252 Paris Cedex 05, France. michel.arluison@snv.jussieu.frArluison, M.Quignon, M.Nguyen, P.Thorens, B.Leloup, C.Penicaud, L.J Chem NeuroanatAnimalsBrain/metabolism/ ultrastructureComparative StudyGlucose Transporter Type 1Glucose Transporter Type 2Glucose Transporter Type 3Glucose Transporter Type 4ImmunohistochemistryMaleMicroscopy, Electron, TransmissionMonosaccharide Transport Proteins/metabolism/ ultrastructureMuscle Proteins/metabolism/ultrastructureNerve Tissue Proteins/metabolism/ultrastructureNeurons/metabolism/ ultrastructureOligodendroglia/metabolism/ultrastructureRatsRats, WistarResearch Support, Non-U.S. Gov'tArluison200457950154829000891-0618 (Print)2832004NovImmunocytochemical localization of the glucose transporter 2 (GLUT2) in the adult rat brain. II. Electron microscopic study137-46Laboratoire de Cytologie, CNRS UMR 7101, Neurobiologie des Signaux Intercellulaires, Universite Pierre et Marie Curie (Paris 6), 7 quai Saint Bernard, 75252 Paris Cedex 05, France. michel.arluison@snv.jussieu.frArluison, M.Quignon, M.Thorens, B.Leloup, C.Penicaud, L.J Chem NeuroanatAnimalsAstrocytes/metabolism/ultrastructureBrain/metabolism/ ultrastructureDendritic Spines/ ultrastructureGlucose Transporter Type 2ImmunohistochemistryMaleMicroscopy, Electron, TransmissionMonosaccharide Transport Proteins/ ultrastructureOligodendroglia/metabolism/ultrastructureRatsResearch Support, Non-U.S. Gov't(Arluison et al. 2004b; Arluison et al. 2004a). However, direct evidence of STZ entering into particular brain cells through GLUT2 is still lacking.
After STZ icv administration, severe abnormalities in brain glucose/energy metabolism have been found; glucose utilization was reduced in 17 of 35 brain areas ADDIN EN.CITE Duelli19948080Intracerebroventricular injection of streptozotocin induces discrete local changes in cerebral glucose utilization in ratsDuelli, R.Schrock, H.Kuschinsky, W.Hoyer, S.AnimalBrain/*metabolismDisease Models, AnimalFrontal Lobe/metabolismGlucose/*metabolismHemodynamicsInjections, SpinalMaleRatsRats, WistarReceptor, Insulin/metabolismStreptozocin/*pharmacologySupport, Non-U.S. Gov'tInt J Dev Neurosci1994128737-43.(Duelli et al. 1994), the activities of glycolytic key enzymes decreased markedly ADDIN EN.CITE Plaschke19938120Action of the diabetogenic drug streptozotocin on glycolytic and glycogenolytic metabolism in adult rat brain cortex and hippocampusPlaschke, K.Hoyer, S.AnimalCerebral Cortex/drug effects/enzymology/*metabolismGlucose/metabolismGlycogen/*metabolismGlycolysis/*drug effectsHippocampus/drug effects/enzymology/*metabolismInjections, IntraventricularInsulin Antagonists/pharmacologyMaleParietal Lobe/drug effects/enzymology/metabolismRatsRats, WistarStreptozocin/administration & dosage/*pharmacologySupport, Non-U.S. Gov'tTemporal Lobe/drug effects/enzymology/metabolismInt J Dev Neurosci1993114477-83.(Plaschke and Hoyer 1993) finally causing diminished concentrations of the energy-rich compounds ATP and creatine phosphate ADDIN EN.CITE Nitsch19919300Local action of the diabetogenic drug, streptozotocin, on glucose and energy metabolism in rat brain cortexNitsch, R.Hoyer, S.Adenosine Diphosphate/metabolismAdenosine Triphosphate/metabolismAnimalCerebral Cortex/drug effects/*metabolismCitric Acid Cycle/drug effectsEnergy Metabolism/*drug effectsGlucose/*metabolismGlycolysis/drug effectsInjections, IntraventricularLactates/metabolismMalePhosphocreatine/analogs & derivatives/metabolismRatsRats, Inbred StrainsStreptozocin/administration & dosage/*pharmacologySupport, Non-U.S. Gov'tNeurosci Lett19911282199-202.Lannert19988030Intracerebroventricular administration of streptozotocin causes long-term diminutions in learning and memory abilities and in cerebral energy metabolism in adult ratsLannert, H.Hoyer, S.Adenosine Diphosphate/metabolismAdenosine Triphosphate/metabolismAlzheimer Disease/chemically induced/*physiopathologyAnimalAvoidance Learning/*drug effectsBehavior, Animal/drug effects/*physiologyBlood Glucose/drug effects/metabolismBrain/drug effects/*metabolismDisease Models, AnimalEnergy Metabolism/drug effects/*physiologyHabituation (Psychophysiology)MaleMemory/drug effects/*physiologyPractice (Psychology)RatsRats, WistarReceptor, Insulin/antagonists & inhibitorsStatistics, NonparametricStreptozocin/pharmacologyBehav Neurosci199811251199-208.(Nitsch and Hoyer 1991; Lannert and Hoyer 1998). Both energy deficit and reduced activity of choline acetyltransferase (cholinergic deafferentiation) ADDIN EN.CITE Hellweg19929230Nerve growth factor and choline acetyltransferase activity levels in the rat brain following experimental impairment of cerebral glucose and energy metabolismHellweg, R.Nitsch, R.Hock, C.Jaksch, M.Hoyer, S.AnimalBrain/*enzymologyBrain Chemistry/*physiologyCholine O-Acetyltransferase/*metabolismEnergy Metabolism/*physiologyGlucose/*metabolismInjections, IntraventricularMaleNerve Growth Factors/*metabolismRatsRats, Inbred StrainsStreptozocin/administration & dosage/pharmacologySupport, Non-U.S. Gov'tJ Neurosci Res1992313479-86.Blokland19938130Spatial learning deficit and reduced hippocampal ChAT activity in rats after an ICV injection of streptozotocinBlokland, A.Jolles, J.AnimalAvoidance Learning/drug effectsCholine O-Acetyltransferase/*drug effects/metabolismComparative StudyDiscrimination Learning/*drug effectsHippocampus/*drug effects/enzymologyInjections, IntraventricularMaleRandom AllocationRatsRats, Inbred LewReproducibility of Results*Spatial BehaviorStreptozocin/administration & dosage/*pharmacologyPharmacol Biochem Behav1993442491-4.(Hellweg et al. 1992; Blokland and Jolles 1993) may form the biological basis for the marked reduction in learning and memory capacities ADDIN EN.CITE Lannert19988030Intracerebroventricular administration of streptozotocin causes long-term diminutions in learning and memory abilities and in cerebral energy metabolism in adult ratsLannert, H.Hoyer, S.Adenosine Diphosphate/metabolismAdenosine Triphosphate/metabolismAlzheimer Disease/chemically induced/*physiopathologyAnimalAvoidance Learning/*drug effectsBehavior, Animal/drug effects/*physiologyBlood Glucose/drug effects/metabolismBrain/drug effects/*metabolismDisease Models, AnimalEnergy Metabolism/drug effects/*physiologyHabituation (Psychophysiology)MaleMemory/drug effects/*physiologyPractice (Psychology)RatsRats, WistarReceptor, Insulin/antagonists & inhibitorsStatistics, NonparametricStreptozocin/pharmacologyBehav Neurosci199811251199-208.(Lannert and Hoyer 1998). Furthermore, a direct histopathological evidence of specific neurotoxic damage caused by STZ icv administration to axons and myelin in the fornix, anterior hippocampus and periventricular structures that are essential for learning and spatial memory, have been reported ADDIN EN.CITE Shoham2003527701476939918422003DecIntracerebroventricular injection of streptozotocin causes neurotoxicity to myelin that contributes to spatial memory deficits in rats1043-52Research Department, Herzog Hospital, School of Pharmacy, Hebrew University Medical Centre, Jerusalem, Israel.Shoham, S.Bejar, C.Kovalev, E.Weinstock, M.Exp NeurolWeinstock200453220Weinstock, M.Shoham, S.2004Rat models of dementia based on reductions in regional glucose metabolism, cerebral blood flow and cytochrome oxidase activity.J Neural Transm1113347-366(Shoham et al. 2003; Weinstock and Shoham 2004).
Regarding the brain IR signaling, a recent investigation focusing on the downstream phosphatidylinositol-3 (PI3)-kinase signaling pathway showed abnormalities of Akt/protein kinase B level and of both phosphorylated and non-phosphorylated glycogen synthase kinase-3(/( protein 1 month and 3 months after STZ icv administration ADDIN EN.CITE Salkovic-Petrisic200656700164120930022-3042 (Print)9642006FebAlzheimer-like changes in protein kinase B and glycogen synthase kinase-3 in rat frontal cortex and hippocampus after damage to the insulin signalling pathway1005-15Department of Pharmacology and Croatian Institute for Brain Research, School of Medicine, University of Zagreb, Zagreb, Croatia.Salkovic-Petrisic, M.Tribl, F.Schmidt, M.Hoyer, S.Riederer, P.J Neurochem(Salkovic-Petrisic et al. 2006). In the latter study, an increase in total tau-protein in the brain and amyloid formation in leptomeningeal vessels were found.
The data available so far point to different aspects: 1. STZ icv administration causes severe abnormalities in metabolic pathways being under control of the insulin/insulin receptor signaling cascade in the rat brain. 2. Observed changes seem to demonstrate great similarities to cellular and intracellular abnormalities found in the SAD brain. 3. The mechanism of STZ icv action is not known, however it could be hypothesized that in general it is similar to the mechanism of STZ peripheral action. Therefore, we were interested in studying abnormalities of the brain insulin signal transduction cascade at the gene expression and protein expression/activity levels, which may be induced by STZ icv application. The abnormalities found served for tentative comparison with changes characteristic for SAD. Using learning and memory capacities as sensitive markers, the interaction of glucose transporter and STZ for elucidating possible mechanism of STZ icv action was studied in an additional approach.
Material and Methods
Material
Streptozotocin was purchased from Sigma-Aldrich (Munich, Germany). Protein Tyrosine Kinase Activity assay kit was purchased from Chemicon International (Hampshire, United Kingdom; Cat. No. SGT410). For buffer preparations EGTA (Cat. No. E4378), Tris buffer, Na3VO4 (Cat. No. S6508), EDTA 0.5 M (Cat. No. E7889), Protease Inhibitor mix (Cat. No. P8340), Sodium Deoxychlorate (Cat. No. D6750), BSA, - m e r c a p t o e t h a n o l ( C a t . N o . M 7 1 5 4 ) a n d t h e I n s u l i n R e c e p t o r S u b u n i t E L I S A ( C a t . N o . C S 0 0 0 9 0 ) w e r e p u r c h a s e d f r o m S i g m a - A l d r i c h ( M u n i c h , G e r m a n y ) . D T T ( C a t . N o . 4 3 8 1 7 ) w a s p u r c h a s e d f r o m F l u k a ( G e r m a n y ) . 5 - t h i o - D - g l u c o s e a n d 3 - 0 m e t h y l g l u c o s e w e r e p u r c h a s e d from Sigma-Aldrich Chemie (Munich, Germany). The polyclonal rabbit anti-human tau (K9JA) antibody (recognizes total tau at C-terminal part, amino acids 243-441) and monoclonal PHF-1 anti-tau antibody (recognizes tau phoshorylated at serine S-396 and S-404) were received as a gift from Dr. E-M Mandelkow (Max-Planck-Gesellschaft, Hamburg, Germany), although the first commercially originated from DAKOCytomation (Glostrup, Denmark) and the latter was from Dr. Peter Davies (Albert Einstein College of Medicine, Bronx, New York). Anti-rabbit IgG, HRP-linked antibody and anti-mouse IgG, HRP-linked antibody were purchased from Cell Signalling (Beverly, MA, USA). Chemiluminiscent Western blot detection kit was from Amersham Biosciences (Freiburg, Germany). Gels were from Novex (San Diego, CA, USA), and nitrocellulose membranes were from Invitrogen (Invitrogen GmbH, Karlsruhe, Germany).
Animals
Three to four-month old male Wistar rats weighing 280-330 g (Department of Pharmacology, School of Medicine, University of Zagreb) were used throughout the studies. Animals were kept on standardized food pellets and water ad libitum.
Drug treatments
Rats were randomly divided into groups (5-6 per group) and given general anaesthesia (chloralhydrate 300 mg/kg, ip), followed by injection of different drugs administered bilaterally into the left and right lateral ventricle according to the procedure described by Noble et al. ADDIN EN.CITE Noble19675804060718720024-3205 (Print)631967Feb 1A simple and rapid method for injecting H3-norepinephrine into the lateral ventricle of the rat brain281-91Noble, E. P.Wurtman, R. J.Axelrod, J.Life SciAnimalsAutoradiographyBasal Ganglia/metabolismCerebellum/metabolismCerebral Cortex/metabolismCerebral VentriclesDesipramine/pharmacologyDextroamphetamine/pharmacologyFemaleHippocampus/metabolismHypothalamus/metabolismIn VitroInjections, SpinalMedulla Oblongata/metabolismMesencephalon/metabolismNorepinephrine/ administration & dosage/metabolismNormetanephrine/pharmacologyRatsReserpine/pharmacologyTritium(Noble et al. 1967). Drug concentration and solution volume was adjusted according to the animal body weight, and a volume of 4 L p e r 3 0 0 g b o d y w e i g h t w a s a d m i n i s t e r e d ( 2 L / v e n t r i c l e ) . C o n t r o l a n i m a l s r e c e i v e d b i l a t e r a l l y a n e q u a l v o l u m e o f v e h i c l e i n t o t h e l a t e r a l v e n t r i c l e s .
F o r t h e I R a n d t a u p r o t e i n a n a l y s e s , r a t s w e r e t r e a t e d i c v w i t h a s i n g l e S T Z i n j e c t i o n ( 1 m g / k g , d i s s o lved in 0.05M citrate buffer pH 4.5). STZ-treated and respective control animals were sacrificed 3 months following the drug treatment.
In the behavioural experiment, rats were randomly divided in 5 groups and the following drug icv treatments were applied:
group I: 0.05M citrate buffer pH 4.5, applied 3 times, on day 1, 3 and 21 (control group, CTRL)
group II: STZ 1 mg/kg, dissolved in 0.05M citrate buffer pH 4.5; applied once - on day 1, and citrate buffer applied icv on day 3 and 21 (STZ 1x)
group III: STZ 1 mg/kg, dissolved in 0.05M citrate buffer pH 4.5; applied 3 times on day 1, 3 and 21 (STZ 3x)
group IV: 3-0-methyl-glucose (30MG) 1 mg/kg followed by STZ 1 mg/kg, both dissolved in 0.05M citrate buffer pH 4.5; applied 3 times by separate consecutive injections on day 1, 3 and 21 (STZ 3x +30MG 3x)
group V: 5 - t h i o - D - g l u c o s e ( T G ) 3 7 5 g / k g f o l l o w e d b y S T Z 1 m g / k g , b o t h d i s s o l v e d i n 0 . 0 5 M c i t r a t e b u f f e r p H 4 . 5 ; a p p l i e d 3 t i m e s b y s e p a r a t e c o n s e c u t i v e i n j e c t i o n s o n d a y 1 , 3 a n d 2 1 ( S T Z 3 x + T G 3 x )
F o r t h e I R a n d t a u p r o t e i n a n a l y s e s , b r a i n s w e r e q u i c k l y r e m o v e d, and cut into left and right half. Frontoparietal cortex (IR analysis), hippocampus (IR and tau analyses) and hypothalamus (IR analysis) were cut out from the brain, immediately frozen and stored at -80 oC. The proportions of the right half of the brain were homogenized as described further. STZ-icv-treated animals had no symptoms of systemic diabetes and steady-state blood glucose level did not differ in comparison with control animals.
Young-adult animals were chosen for the study to evaluate also the effect of compensation after damage. Compensation may be assumed to be facilitated in the young-adult brain ADDIN EN.CITE Hoyer19859710The effect of age on glucose and energy metabolism in brain cortex of ratsHoyer, S.Adenosine Triphosphate/metabolism*AgingAnimalCerebral Cortex/*metabolismCitrates/metabolismCitric Acid*Energy MetabolismGlucose/*metabolismKetoglutaric Acids/metabolismLactates/metabolismLactic AcidMalates/metabolismMalePyruvates/metabolismPyruvic AcidRatsRats, Inbred StrainsArch Gerontol Geriatr198543193-203.(Hoyer 1985). Otherwise, a long-term maintenance of the brain damage starting early in life may point to abnormalities characteristic of chronic disorders developing later in life ADDIN EN.CITE Holness200048080Early-life programming of susceptibility to dysregulation of glucose metabolism and the development of Type 2 diabetes mellitusHolness, M. J.Langdown, M. L.Sugden, M. C.AdultAnimalDiabetes Mellitus,Non-Insulin-Dependent/epidemiology/*etiology/metabolism/physiopathologyEmbryo and Fetal DevelopmentFemaleGlucose/*metabolismHumanInsulin/physiologyIslets of LangerhansMaleSupport, Non-U.S. Gov'tBiochem J2000349Pt 3657-65.(Holness et al. 2000)
Quantitative real-time RT-PCR
Total-RNA extraction
Isolation of total RNA was performed using RNeasy Mini Kit (Qiagen GmbH, Germany) for each animal and brain region separately. An additional step was added to the original protocol in order to receive a pure DNA free total-RNA. The total RNA was on column pre-treated with DNase-I and the original protocol was then continued in order to have total RNA extraction. The RNA quality and quantity was assessed using the Experion electrophoresis (BioRad Laboratories, Hercules, CA, USA) which analyses the concentration of the total RNA and quality via the ratio of the 28S / 18S ribosomal RNA. Only intact total RNA samples (with at least 28S/18S ration of 1.7) were used for the gene expression analysis.
Q-PCR
In order to measure the gene expression profile of insulin-1, insulin-2, and insulin-receptor, quantitative real-time RT-PCR for mRNA samples isolated from rats' frontal cortex, hippocampus and hypothalamus were performed. Total RNA (1-0.4 mg) from each sample was reverse transcribed with random hexamer and oligo-dT primers using iScriptTM cDNA Synthesis Kit (BioRad Laboratories, Hercules, CA, USA, Cat. No. 170-8890). The genes measured are listed in Table 1. These were normalized to the house-keeping genes: beta-actin (ActX), ribosomal 18S (Rnr1), and glyceraldehydes-3-phosphate dehydrogenase (GAPDH) (Table 1). The house keeping genes were tested for their stability using the geNorm program ( HYPERLINK "http://medgen.ugent.be/~jvdesomp/genorm/" http://medgen.ugent.be/~jvdesomp/genorm/) ADDIN EN.CITE Vandesompele20025356012184808372002Jun 18Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genesRESEARCH0034Center for Medical Genetics, Ghent University Hospital 1K5, De Pintelaan 185, B-9000 Ghent, Belgium. franki.speleman@rug.ac.beVandesompele, J.De Preter, K.Pattyn, F.Poppe, B.Van Roy, N.De Paepe, A.Speleman, F.Genome BiolAlgorithmsDNA, Complementary/analysis/geneticsFemaleGene Expression Profiling/methods/ standardsHumanRNA/genetics/metabolismReference StandardsReproducibility of ResultsReverse Transcriptase Polymerase Chain Reaction/ standardsSupport, Non-U.S. Gov'tTime FactorsTumor Cells, Cultured(Vandesompele et al. 2002). After analysis for the most stable house-keeping genes, a normalization factor was calculated according to the program. Absence of DNA contamination was verified by amplifying the house-keeping gene, ribosomal 18S, and run on gel to observe no product. Minus RT samples were tested simultaneously with experimental samples by quantitative RT-PCR in order to see whether the reaction did not yield any amplification below 35 cycles using the PCR protocol. Real-time PCR was performed in the iCycler iQ system (BioRad Co., Hercules, CA, USA) as described previously ADDIN EN.CITE Svaren200037940EGR1 target genes in prostate carcinoma cells identified by microarray analysisSvaren, J.Ehrig, T.Abdulkadir, S. A.Ehrengruber, M. U.Watson, M. A.Milbrandt, J.AllelesAmino Acid SubstitutionDNA-Binding Proteins/genetics/*metabolismEnzymes/genetics*Gene Expression Regulation, NeoplasticHumanImmediate-Early Proteins/metabolismInsulin-Like Growth Factor II/*geneticsMaleOligonucleotide Array Sequence AnalysisProstatic Neoplasms/*geneticsProteins/geneticsRecombinant Proteins/metabolismReverse Transcriptase Polymerase Chain ReactionSupport, Non-U.S. Gov'tSupport, U.S. Gov't, P.H.S.Transcription Factors/genetics/*metabolismTransfectionTumor Cells, CulturedJ Biol Chem20002754938524-31.Ugozzoli200237950Fluorescent multicolor multiplex homogeneous assay for the simultaneous analysis of the two most common hemochromatosis mutationsUgozzoli, L. A.Chinn, D.Hamby, K.AllelesDNA Mutational AnalysisDNA Probes/chemistry/geneticsFluorescent DyesGenotypeHemochromatosis/blood/*geneticsHistocompatibility Antigens Class I/blood/*geneticsHumanMembrane Proteins/blood/*geneticsMutation/*geneticsPolymerase Chain ReactionPolymorphism, Restriction Fragment LengthPolymorphism, Single NucleotideReproducibility of ResultsSensitivity and SpecificityAnal Biochem2002307147-53.(Svaren et al. 2000; Ugozzoli et al. 2002). Briefly, 30-100 ng of cDNA and gene specific primers (200nM final concentration) and probes (500nM final concentration; when the assay consist probes) (indicated in Table 1) were added to either QuantiTect SYBR Green PCR Kit (Qiagen Inc., Valencia, CA, USA, Cat. No. 204143) or to iQ Supermix (BioRad Co., Hercules, CA, USA, Cat. No. 170-8862; in case of the probe assays). Real-time PCR were subjected to PCR amplification (in general 1 cycle at 950 C for 15 min, 30-45 cycles at 940 C for 15 s, annealing and detecting of specific fluorescent colour at 550C for 30 s and extension at 760C for 30 s). All PCR reactions were run in triplicate. The amplified transcripts were quantified using the comparative CT method analyzed with the BioRad iCycler iQ system program. Standard curves for each amplification product were generated from 10-fold dilutions of pooled cDNA amplicons, isolated from agarose gel using MinEluteTM Gel Extraction Kit (Qiagen Inc., Valencia, CA, USA), to determine primer efficiency and quantization.
Total Insulin-receptor ( (IR-() subunit & the phosphorylated forms ELISA
Homogenates preparation
Fresh tissue was homogenized one to four volumes of a pre-chilled lysis buffer containing 50mM Tris, pH 8.0, 150 mM NaCl, 0.5 mM EDTA, 1 mM DTT, 1% NP-40, 0.5% Sodium Deoxychlorate, 0.1% SDS protease inhibitors cocktail and 100 M Sodium Vanadate. The homogenate were centrifuged at 12,000 x g for 10 minutes at 40C to pellet the fraction. The supernatant was than stored at -700C till further analysis in aliquots.
Total protein concentration determination
The amount of protein was assayed according to the method of Bradford ADDIN EN.CITE Bradford197614360Bradford, M.M.1976Rapid and sensitive method for quantitation of microgram quantities of proteins utilizing principle of protein dye binding.Anal Biochem72248-254(Bradford 1976) (Sigma, Cat. No. B6916). For calibration curve BSA standard was used (Sigma, Munich, Germany). The concentration was determined by measurement of the absorbance at 595 nm.
ELISA
The measurement of the ph o s p h o r y l a t e d a n d n o n - p h o s p h o r y l a t e d I R - s u b u n i t w a s c o n d u c t e d a c c o r d i n g t o t h e k i t m a n u a l ( S i g m a , C a t . N o . C S 0 0 9 0 f o r I R - s u b u n i t ; C a t . N o . P I 0 1 0 0 f o r P h o s p h o - I R - s u b u n i t p T y r 1 1 5 8 ; C a t . N o . P I 0 2 0 0 f o r P h o s p h o - I R - s u b u n i t p T y r 1 1 6 2 / 1 1 6 3 ) . H o m o g e n a t e s w e r e diluted with buffer diluents one to ten volumes. Standard curve analysis was run in parallel on each plate. The absorbance was measured in the Multiskan Spectrum spectrophotometer at OD 450 nm (Thermo Labsystems, Finland). Further analyses of the results were performed on a PC Excel windows program.
Protein Tyrosine kinase activity assay
The activity of the IR protein Tyrosine Kinase (PTK) was conducted according to the kit manual (Chemicon, Cat. No. SGT410). Tyrosine Kinase Activity Assay Kit measures the total activity of the protein tyrosine kinase residues on the insulin receptor. The buffer assay used in this PTK activity was as recommended in the manual from Upstate Ltd (Dundee, UK, Kinase Profiler Assay Protocols). The assay buffer contained 50mM Tris, pH 7.5, 0.1 mM EGTA, 0.1 mM Na3VO4 , 0 . 1 % - m e r c a p t o e t h a n o l a n d 1 m g / m l B S A . T h e h o m o g e n a t e w a s u s e d i n a o n e v o l u m e t o 5 . 7 v o l u m e s o f t o t a l r e a c t i o n m i x f o r t h e r e a c t i o n . S t a n d a r d c u r v e a n a l y s i s w a s r u n i n p a r a l l e l o n e a c h p l a t e . T h e a b s o r b a n c e w a s m e a s u r e d i n t h e M u l t i s k a n S p e c t r u m s p e c t r o photometer at OD 450 nm (Thermo Labsystems, Finland). Further analyses of the results were performed on a PC Excel windows program.
Western blot
Tissue preparation.
Hippocampal (1 animal = 1 sample) tissue samples from the left half of the rat brain were homogenized with 3 volumes of lysis buffer containing 10 mM HEPES, 1 mM EDTA, 100 mM KCl, and 1% Triton X-100, pH 7.5, and protease inhibitors coctail (1:100), and the homogenates were centrifuged at 600xg for 10 min. The supernatants were further centrifu g e d a t 4 5 0 0 0 x g f o r 3 0 m i n a t 4 o C , a n d t h e p e l l e t s w e r e r e s u s p e n d e d i n 1 0 0 L o f t h e l y s i s b u f f e r . F i n a l l y , t h e r e s u s p e n d e d p e l l e t s w e r e m i x e d w i t h a p p r o p r i a t e p r e v i o u s s u p e r n a t a n t s o b t a i n e d a f t e r s e c o n d c e n t r i f u g a t i o n . P r o t e i n c o n c e n t r a t i o n w a s m e a s u r e d b y B r a d f o r d P r o t e i n a s s a y . S a m p l e s w e r e f r o z e n a n d s t o r e d a t - 8 0 o C .
I m m u n o b l o t t i n g .
E q u a l a m o u n t s o f t o t a l p r o t e i n ( 5 0 g p e r s a m p l e ) w e r e s e p a r a t e d b y S D S - P A G E u s i n g 8 % p o l y a c r y l a m i d e g e l s a n d t r a n s f e r r e d t o n i t r o c e l l u l o s e m e m b r a n e s A D D I N E N . C I T E < EndNote>Schneppenheim19915641016821450173-08351251991MayLuminography--a new, highly sensitive visualization method for electrophoresis367-72Abteilung Allgemeine Paediatrie, Klinikum der Christian-Albrechts-Universitat, Kiel, Germany.Schneppenheim, R.Budde, U.Dahlmann, N.Rautenberg, P.ElectrophoresisAnimalsAntibodies, Heterophile/analysisAutoradiographyBlotting, Western/ methodsChromogenic Compounds/diagnostic useComparative StudyDensitometryElectrophoresis, Polyacrylamide Gel/ methodsGliadin/immunologyHIV Antibodies/analysisHorseradish Peroxidase/analysisHumansHydrogen Peroxide/diagnostic useImmunoglobulin G/analysisIsoelectric Focusing/ methodsLuminescent MeasurementsLuminol/ diagnostic useMiceResearch Support, Non-U.S. Gov'tTransglutaminases/analysisvon Willebrand Factor/analysis(Schneppenheim et al. 1991). The nitrocellulose membranes were blocked by incubation in 5% non-fat milk added to low salt washing buffer (LSWB) containing 10 mM Tris and 150 mM NaCl, pH 7.5, and 0.5% Tween 20, one hour at room temperature. Blocked blots were incubated overnight at 4 oC with respective primary anti-total tau (1: 10 000), and anti PHF-1-tau antibodies (1:300). Following the incubation, the membranes were washed three times with LSWB and incubated for 60 min at room temperature with secondary antibody solution (anti-rabbit IgG, 1:2000, and anti-mouse IgG, 1:500). The specificity of the signal was checked on the control membranes that were not incubated with the primary antibody. After washing three times in LSWB, the membranes were immunostained using chemiluminiscence Western blotting detection reagents, signal captured and visualised with the Chemi Doc BioRad (UK) video camera system.
Morris Water Maze Swimming Test
Cognitive functions were tested in Morris Water Maze Swimming Test ADDIN EN.CITE Anger19915803017454320161-813X (Print)1231991FallAnimal test systems to study behavioral dysfunctions of neurodegenerative disorders403-13Center for Research on Occupational and Environmental Toxicology, Oregon Health Sciences University, Portland 97201.Anger, W. K.NeurotoxicologyAlzheimer Disease/psychologyAnimalsBehavior, Animal/physiologyCognition Disorders/ physiopathologyDisease Models, AnimalNerve DegenerationNervous System Diseases/chemically induced/ psychologyResearch Support, U.S. Gov't, P.H.S.(Anger 1991) twice, 2 weeks and 2 months after the first drug icv injection. Adaptation of rats to the experimental environment and behavioural activity was done during two days before the experimental trials. On the first of these two days animals were subjected to 1 min of freely swimming in a pool (150x60 cm, 50 cm deep), with water temperature set at 251 oC, and on the second day rats were allowed to freely swim in the pool divided in four quadrants (I-IV). In the experimental trials, performed from day 1 to day 4, rats were thought to escape from water by finding a hidden rigid platform submerged about 2 cm below the water surface in quadrant IV. Stay on the platform was allowed for 15 sec. One trial consisted of three starts, each from a different quadrant (I III), separated by a 1-min rest period. Three consecutive trials were performed per day, separated by a 30-min rest period. After the third trial on day 4, the fourth trial was performed (starts from quadrants I-III) with a platform being removed from the pool, and the time spent in searching for the platform after entering quadrant IV was recorded. The cut off time was 1 min. Those rats who had no alterations in memory functions (control) were supposed to remember that the platform had previously been there, and, in line with that, to spend a long time swimming within quadrant IV, looking for the platform. In case of drug-induced deterioration of memory functions, rats were supposed to remember less intensively that the platform had been in quadrant IV, and thus to spend less time in searching for the platform within this quadrant, in comparison with control rats.
Statistics
The differences of gene expression in the different brain regions were compared using the one-way- analysis of variance (ANOVA) with Post-Hoc Test of Scheffe, using the StatView computer program (Stat View 5.0. software, SAS Institute Inc. Cary, NC, USA) on a PC computer. Statistically significant differences were accepted at p<0.05.
Densitometric values of proteins obtained in Western blot analysis were expressed as percentage of the control group on the respective gel (mean SE), and the significance of between-group difference was tested by Mann-Whitney U-test. P<0.05 was considered significant. In the Morris Water Maze Swimming Test, values were expressed as total time (seconds) spent in searching for the hidden platform in quadrant IV during the three consecutive starts from quadrant I-III in the last experimental trial. Mean values with a standard error and standard deviation range were presented. The significance of between-group differences was tested by Kruskal-Wallis ANOVA median test, followed by Mann-Whitney U-test, and p<0.05 considered statistically significant for both tests.
Ethics
The experiments carried out on 3 to 4-month-old rats in Zagreb, Croatia, were under the guidance of the Principles of Laboratory Animal care (NIH Publication No. 86-23, revised in 1985), according to the Croatian Act on Animal Welfare (NN19; 1999) and were approved by The Ethics Committee of the Zagreb University School of Medicine (No. 04-1343-2006). Results
IR analyses
Control rats. In Table 2A, the normalized gene expression profiles of the insulin receptor, insulin-1 and insulin-2 mRNA and their ratio under control conditions in frontoparietal brain cortex, hippocampus and hypothalamus are demonstrated. The expression profiles of the IR gene in frontoparietal brain cortex and hippocampus are in the same range, which seem to be higher as compared to the hypothalamus. However, statistically significant difference was not found. Both the expression of the insulin-1 and insulin-2 genes was highest in hippocampus, followed by frontoparietal brain cortex and hypothalamus. In the latter, insulin-1 gene expression was significantly decreased as compared to the hippocampus. The ratio of the expression of the insulin-1 and -2 genes was highest in hippocampus, and nearly i n t h e s a m e r a n g e i n f r o n t o p a r i e t a l b r a i n c o r t e x a n d h y p o t h a l a m u s .
T a b l e 2 B s h o w s t h e c o n c e n t r a t i o n o f t h e t o t a l I R - s u b u n i t , t h e c o n c e n t r a t i o n s o f p h o s p h o r y l a t e d t y r o s i n e r e s i d u e s 1 1 5 8 ( p T y r 1 1 5 8 ) a n d 1 1 6 2 / 1 1 6 3 ( p T y r 1 1 6 2 / 1 1 6 3 ) p e r I R - ( s u b u n i t , t h e a c t i v i t y o f p r o t e i n t y r o s i n e k i n a s e ( P T K ) a n d t h e r a t i o o f P T K a n d t h e t w o p h o s p h o r y l a t e d t y r o s i n e r e s i d u e s . T h e c o n c e n t r a t i o n o f t h e I R - s u b u n i t w a s h i g h e s t i n f r o n t o p a r i e t a l b r a i n c o r t e x ( p < 0 . 0 5 ) c o m p a r e d t o h i p p o c a m p u s a n d h y p o t h a l a m u s . T h e c o n c e n t r a t i o n o f pTyr1158 per IR-( subunit was highest in hippocampus as compared to frontoparietal brain cortex (p<0.05) and to hypothalamus. The concentration of pTyr1162/1163 per IR-( subunit was found to be less concentrated in both frontoparietal brain cortex and hippocampus compared to hypothalamus. Both residues may be phosphorylated to the same degree in all brain areas studied. The highest activity of PTK was found in frontoparietal brain cortex as compared to hippocampus and hypothalamus. The PTK activity per phosphorylated tyrosine residue was found to be in the same range in each brain region studied. However, regional differences became obvious with significantly higher ratio in frontoparietal brain cortex and lower ratio in hippocampus and hypothalamus (p<0.0005).
STZ-icv treated rats. The effect of STZ icv on the gene expression profiles of insulin receptor, insulin-1 and insulin-2 mRNA in frontoparietal brain cortex, hippocampus and hypothalamus compared to controls is demonstrated in Figure 1. In both frontoparietal brain cortex and hippocampus a statistically significant insulin receptor mRNA down-regulation was observed (16% and 33% of control, respectively). In principle, the expression of both insulin-1 and -2 mRNAs demonstrated a trend of down-regulation after STZ icv treatment. A significant down regulation of insulin-1 mRNA (20% of control) was observed in the hippocampus (p<0.05). Insulin-2 mRNA expression was significantly down-regulated to 11% of control in the frontoparietal brain cortex (p<0.05). The ratio of insulin-1 and insulin-2 expression has not been found statistically significantly changed in STZ icv treated rats either in comparison to the control group or between the three regions.
The protein content of the functionally important IR-( subunit dropped to ~67% (of control) in the frontoparietal brain cortex, increased in the hippocampus (169% of control) and decreased in the hypothalamus (74% of control) after STZ icv treatment (Figure 2). STZ icv caused a significant increase in the concentrations of both pTyr1158 and pTyr1162/1163 in frontoparietal brain cortex, and in hypothalamus (pTyr1162/1163 only) as compared to control. The activity of the PTK was unchanged in both frontoparietal brain cortex and hypothalamus after STZ injection, but increased significantly nearly 3-fold in hippocampus (Figure 2) (p<0.005). Regional difference was found in the ratio of PTK activity per pTyr1158 with statistically significant increase (60%) demonstrated in hippocampus and no change found in the other two regions. Ratio of PTK activity per pTyr1162/1163 was not significantly different between the regions (Figure 2).
Tau protein
The immunoreaction of total tau (recognizing total tau protein at C-terminal part, amino acids 243-441) and p-tau (recognizing tau phoshorylated at serine S-396 and S-404, ie. GSK-3 related tau phosphorylation) increased significantly (177% and 90%, respectively, P<0.05) in the hippocampus of STZ icv treated rats, in comparison to the control animals, as measured 3 months following the drug treatment (Figure 3 A-C).
Learning and memory function
Morris Water Maze Swimming Test discriminated rats that had no alterations in learning and memory functions from those who have. The former ones remembered where the platform had previously been, and in line with that, spent a long time swimming within the appropriate quadrant looking for the platform. Rats with reduction of these functions, remembered less intensively where the platform had previously been, and in line with that spent less time in searching for the removed platform, in comparison with control rats. STZ 1x1 mg/kg and 3x1 mg/kg icv treated rats spent significantly less time in search for the removed platform, in comparison to the control group, found as early as 2 weeks following the first drug treatment (75.8 sec and 76.85 sec vs. 86.4 sec, respectively, P<0.05)(Figure 4). These STZ icv induced cognitive deficits were persistent as found also 2 months following the first drug treatment (66.7 sec and 57.6 sec vs. 110.2 sec, respectively, P<0.05) (Figure 4).
Interestingly, icv pre-administration of glucose transport inhibitors, 30MG and TG followed by STZ icv administration, also induced significant cognitive deficits in comparison to the control rats, found as early as 2 weeks after the first drug treatment (50.2 sec and 48.0 sec vs. 86.4 sec, respectively, P<0.05), and persistent as long as 2 months after the first drug treatment (47.5 sec and 62.0 sec vs. 110.25 sec, respectively, P<0.05) (Figure 4). Therefore, glucose transport inhibitor pre-treatment did not abolished STZ icv-induced cognitive deficits (Figure 4).
Discussion
The normal brain
The present study suggests a dispersed gene expression of the IR and the two insulins throughout the brain thus supporting former findings ADDIN EN.CITE Devaskar19945621081325710021-9258269111994Mar 18Insulin gene expression and insulin synthesis in mammalian neuronal cells8445-54Department of Pediatrics, St. Louis University School of Medicine, Missouri.Devaskar, S. U.Giddings, S. J.Rajakumar, P. A.Carnaghi, L. R.Menon, R. K.Zahm, D. S.J Biol ChemAging/metabolismAmino Acid SequenceAnimalsBase SequenceBrain/growth & development/ metabolismCell Nucleus/metabolismCells, CulturedGene ExpressionInsulin/ biosynthesis/ geneticsIslets of Langerhans/metabolismMolecular Sequence DataNeuroglia/metabolismNeurons/ metabolismPolymerase Chain ReactionRNA, Messenger/analysis/ biosynthesisRabbitsRatsRats, Sprague-DawleyResearch Support, U.S. Gov't, Non-P.H.S.Research Support, U.S. Gov't, P.H.S.Transcription, GeneticUnger19895625027710550306-45223111989Distribution of insulin receptor-like immunoreactivity in the rat forebrain143-57Department of Neurology, University of Rochester School of Medicine and Dentistry, NY 14642.Unger, J.McNeill, T. H.Moxley, R. T., 3rdWhite, M.Moss, A.Livingston, J. N.NeuroscienceAnimalsBrain MappingFrontal Lobe/cytology/ metabolismImmunohistochemistryMaleRatsRats, Inbred StrainsReceptor, Insulin/ metabolismResearch Support, Non-U.S. Gov'tResearch Support, U.S. Gov't, P.H.S.(Unger et al. 1989; Devaskar et al. 1994). The expression of IR mRNA showed a tendency to be higher in frontoparietal brain cortex and in hippocampus than in hypothalamus. Rats and mice possess two insulin genes (1 and 2) both of which are localized to chromosome 1 ADDIN EN.CITE Todd1985567601985Genes for insulin I and II, parathyroid hormone, and calcitonin are on rat chromosome 1Biochemical and Biophysical Research Communications13131175-11801985/9/30Todd, S.Yoshida, M. C.Fang, X. E.McDonald, L.Jacobs, J.Heinrich, G.Bell, G. I.Naylor, S. L.Sakaguchi, A. Y.http://www.sciencedirect.com/science/article/B6WBK-4FFPRGX-2P/2/3d30cd57ac06b1ba9444d4aab0cfd5f1(Todd et al. 1985). It is noteworthy that the expression of both insulin-1 and insulin-2 was found to be relatively high-level in the hippocampus followed by frontoparietal brain cortex, and by lower values in hypothalamus, in accordance with literature data. It has been hypothesized that different distribution patterns of insulin-1 and IR in the brain may suggest that IR in different brain regions may use insulin from different sources, peripheral versus locally synthesized, for cell-to-cell communication and neuronal signal transduction ADDIN EN.CITE Zhao200453600Insulin and the insulin receptor in experimental models of learning and memoryZhao, W. Q.Chen, H.Quon, M. J.Alkon, D. L.Eur J Pharmacol20044901-371-81.(Zhao et al. 2004). Interestingly, in post-mortem aged control subjects, insulin gene expression was also highest in the hippocampus ADDIN EN.CITE Steen200556740157502151387-2877 (Print)712005FebImpaired insulin and insulin-like growth factor expression and signaling mechanisms in Alzheimer's disease--is this type 3 diabetes?63-80Department of Pathology, Rhode Island Hospital and Brown Medical School, Providence, RI 02903, USA.Steen, E.Terry, B. M.Rivera, E. J.Cannon, J. L.Neely, T. R.Tavares, R.Xu, X. J.Wands, J. R.de la Monte, S. M.J Alzheimers DisAlzheimer Disease/genetics/metabolism/physiopathologyBrain/immunology/ metabolismCerebral Cortex/immunology/metabolismDNA Primers/geneticsDiabetes Mellitus/genetics/immunology/metabolismGlycogen Synthase Kinase 3/genetics/immunology/metabolismHumansHypothalamus/immunology/metabolismImmunohistochemistryImmunoprecipitationInsulin/immunology/ metabolismInsulin-Like Growth Factor I/ genetics/immunology/ metabolismInsulin-Like Growth Factor II/ genetics/immunology/ metabolismRNA, Messenger/geneticsResearch Support, N.I.H., ExtramuralResearch Support, U.S. Gov't, P.H.S.Reverse Transcriptase Polymerase Chain ReactionSignal Transduction/ physiologytau Proteins/metabolism(Steen et al. 2005).
In this first in vivo-study performed at the protein level, a striking d i s s o c i a t i o n b e t w e e n I R - s u b u n i t a n d t o t a l I R m R N A w a s f o u n d a m o n g t h e b r a i n a r e a s s t u d i e d r e p o r t e d e a r l i e r a l s o b y Z h a o a n d c o l l e a g u e s A D D I N E N . C I T E < E n d N o t e > < C i t e > < A u t h o r > Z h a o < / A u t h o r > < Y e a r > 1 9 9 9 < / Y e a r > < R e c N u m > 3 9 6 6 < / R e c N u m > < M D L > < R E F E R E N C E _ T Y P E > 0 < / R E F E R E NCE_TYPE>Brain insulin receptors and spatial memory. Correlated changes in gene expression, tyrosine phosphorylation, and signaling molecules in the hippocampus of water maze trained ratsZhao, W.Chen, H.Xu, H.Moore, E.Meiri, N.Quon, M. J.Alkon, D. L.3T3 CellsAnimalBrain/drug effects/*metabolism/*physiologyCalcium/pharmacologyCerebral Cortex/metabolismGene Expression RegulationHippocampus/drug effects/metabolismIntramolecular Transferases/metabolismMAP Kinase Signaling SystemMaleMaze Learning*MemoryMiceMolecular Sequence DataPhosphorylation/drug effectsProteins/metabolismRNA, Messenger/metabolismRatsRats, WistarReceptor, IGF Type 1/metabolismReceptor, Insulin/genetics/*metabolismSignal Transduction/drug effectsSpatial BehaviorTime FactorsTyrosine/metabolismJ Biol Chem19992744934893-902.(Zhao et al. 1999). This finding is difficult to understand, and further studies are needed to clarify whether or not the translational efficiency and/or the IR protein stability is region-dependent e.g. that the turnover of the complete IR protein may be regionally different i.e. higher in the metabolically particularly active hippocampus relative to other brain regions. That differences of receptor concentration and protein turnover are regionally different has, in principle, been demonstrated between different brain areas in favor of the hippocampus ADDIN EN.CITE Zhao199939660Brain insulin receptors and spatial memory. Correlated changes in gene expression, tyrosine phosphorylation, and signaling molecules in the hippocampus of water maze trained ratsZhao, W.Chen, H.Xu, H.Moore, E.Meiri, N.Quon, M. J.Alkon, D. L.3T3 CellsAnimalBrain/drug effects/*metabolism/*physiologyCalcium/pharmacologyCerebral Cortex/metabolismGene Expression RegulationHippocampus/drug effects/metabolismIntramolecular Transferases/metabolismMAP Kinase Signaling SystemMaleMaze Learning*MemoryMiceMolecular Sequence DataPhosphorylation/drug effectsProteins/metabolismRNA, Messenger/metabolismRatsRats, WistarReceptor, IGF Type 1/metabolismReceptor, Insulin/genetics/*metabolismSignal Transduction/drug effectsSpatial BehaviorTime FactorsTyrosine/metabolismJ Biol Chem19992744934893-902.Stecher19978930Learning abilities depend on NMDA-receptor density in hippocampus in adult ratsStecher, J.Muller, W. E.Hoyer, S.AnimalCell Membrane/metabolismCerebral Cortex/metabolism/physiologyDizocilpine Maleate/pharmacokineticsExcitatory Amino Acid Antagonists/pharmacokineticsHippocampus/metabolism/*physiologyKineticsLearning/*physiologyLong-Term Potentiation/physiologyMaleMotor Activity/physiologyRatsRats, WistarReceptors, N-Methyl-D-Aspartate/*physiologyJ Neural Transm19971042-3281-9.(Stecher et al. 1997; Zhao et al. 1999).
STZ action in the brain
After systemic application, STZ was found to cause DNA breaks obviously in a dose-dependent manner ADDIN EN.CITE Yamamoto1981567701981Yamamoto, HiroshiUchigata, YasukoOkamoto, HiroshiStreptozotocin and alloxan induce DNA strand breaks and poly(ADP-ribose) synthetase in pancreatic isletsNature1981/11/19/print2945838284-286http://dx.doi.org/10.1038/294284a010.1038/294284a0Kröncke199556780Kröncke, K. D.Fehsel, K.Sommer, A.Rodriguez, M. L.Kolb-Bachofen, V.1995Nitric oxide generation during cellular metabolization of the diabetogenic N-methyl-N-nitroso-urea streptozotozin contributes to islet cell DNA damageBiol Chem Hoppe Seyler3763179-85Mar0177-3593 (Print)7542008Alkylating Agents/pharmacologyAmino Acid Oxidoreductases/metabolismAnimalsBase SequenceCells, CulturedDNA Damage/ physiologyIslets of Langerhans/cytology/drug effects/ metabolismLiver/cytology/metabolismMolecular Sequence DataNitric Oxide/ biosynthesisNitric Oxide SynthaseNitroprusside/pharmacologyPolymerase Chain ReactionRatsResearch Support, Non-U.S. Gov'tSpectrophotometry, UltravioletStreptozocin/ metabolism/toxicityBiomedical Research Centre, MED-Heinrich-Heine-University, Dusseldorf, Germany.(Yamamoto et al. 1981; Krncke et al. 1995) through intracellular mechanisms, and after being transported into the cell by the GLUT2-transporter detailed by Szkudelski ADDIN EN.CITE Szkudelski200157920118293140862-8408 (Print)5062001The mechanism of alloxan and streptozotocin action in B cells of the rat pancreas537-46Department of Animal Physiology and Biochemistry, University of Agriculture, Poznan, Poland.Szkudelski, T.Physiol ResAlloxan/ pharmacologyAnimalsAntibiotics, Antineoplastic/ pharmacologyDiabetes Mellitus, Experimental/ chemically induced/metabolismIslets of Langerhans/ drug effects/metabolismRatsStreptozocin/ pharmacology(Szkudelski 2001). It is, however, not known as yet whether or not comparable mechanisms take place in the brain after STZ icv administration, too. As a sensitive marker of STZ action in the brain, the development of long-lasting disturbances in learning and memory capacities has been repeatedly shown as a consequence of diverse abnormalities in neuronal glucose metabolism ADDIN EN.CITE Mayer19909350Effects of changes in peripheral and cerebral glucose metabolism on locomotor activity, learning and memory in adult male ratsMayer, G.Nitsch, R.Hoyer, S.AnimalAvoidance Learning/drug effects/*physiologyBlood Glucose/metabolismBrain/drug effects/*metabolismGlucose/*metabolismInjections, IntraperitonealInjections, IntraventricularMaleMemory/drug effects/*physiologyMotor Activity/drug effects/*physiologyRatsRats, Inbred StrainsStreptozocin/pharmacologyBrain Res19905321-295-100.Lannert19988030Intracerebroventricular administration of streptozotocin causes long-term diminutions in learning and memory abilities and in cerebral energy metabolism in adult ratsLannert, H.Hoyer, S.Adenosine Diphosphate/metabolismAdenosine Triphosphate/metabolismAlzheimer Disease/chemically induced/*physiopathologyAnimalAvoidance Learning/*drug effectsBehavior, Animal/drug effects/*physiologyBlood Glucose/drug effects/metabolismBrain/drug effects/*metabolismDisease Models, AnimalEnergy Metabolism/drug effects/*physiologyHabituation (Psychophysiology)MaleMemory/drug effects/*physiologyPractice (Psychology)RatsRats, WistarReceptor, Insulin/antagonists & inhibitorsStatistics, NonparametricStreptozocin/pharmacologyBehav Neurosci199811251199-208.Salkovic-Petrisic200656700164120930022-3042 (Print)9642006FebAlzheimer-like changes in protein kinase B and glycogen synthase kinase-3 in rat frontal cortex and hippocampus after damage to the insulin signalling pathway1005-15Department of Pharmacology and Croatian Institute for Brain Research, School of Medicine, University of Zagreb, Zagreb, Croatia.Salkovic-Petrisic, M.Tribl, F.Schmidt, M.Hoyer, S.Riederer, P.J Neurochem(Mayer et al. 1990; Lannert and Hoyer 1998; Salkovic-Petrisic et al. 2006). In particular, the cholinergic transmission as the basis for learning and memory capacities has been demonstrated to be severely disturbed inducing gene expression of choline acetyltransferase ADDIN EN.CITE Lester-Coll200657970166279311387-2877 (Print)912006MarIntracerebral streptozotocin model of type 3 diabetes: relevance to sporadic Alzheimer's disease13-33Department of Medicine, Rhode Island Hospital and Brown Medical School, Providence, RI 02903, USA.Lester-Coll, N.Rivera, E. J.Soscia, S. J.Doiron, K.Wands, J. R.de la Monte, S. M.J Alzheimers Dis(Lester-Coll et al. 2006) the activity of this enzyme ADDIN EN.CITE Blokland19938130Spatial learning deficit and reduced hippocampal ChAT activity in rats after an ICV injection of streptozotocinBlokland, A.Jolles, J.AnimalAvoidance Learning/drug effectsCholine O-Acetyltransferase/*drug effects/metabolismComparative StudyDiscrimination Learning/*drug effectsHippocampus/*drug effects/enzymologyInjections, IntraventricularMaleRandom AllocationRatsRats, Inbred LewReproducibility of Results*Spatial BehaviorStreptozocin/administration & dosage/*pharmacologyPharmacol Biochem Behav1993442491-4.Ishrat200658010166210540166-4328 (Print)17112006Jul 15Coenzyme Q10 modulates cognitive impairment against intracerebroventricular injection of streptozotocin in rats9-16Neurotoxicology Laboratory, Department of Medical Elementology and Toxicology, Jamia Hamdard (Hamdard University), New Delhi, India.Ishrat, T.Khan, M. B.Hoda, M. N.Yousuf, S.Ahmad, M.Ansari, M. A.Ahmad, A. S.Islam, F.Behav Brain Res(Blokland and Jolles 1993; Ishrat et al. 2006) and its function ADDIN EN.CITE Hellweg19929230Nerve growth factor and choline acetyltransferase activity levels in the rat brain following experimental impairment of cerebral glucose and energy metabolismHellweg, R.Nitsch, R.Hock, C.Jaksch, M.Hoyer, S.AnimalBrain/*enzymologyBrain Chemistry/*physiologyCholine O-Acetyltransferase/*metabolismEnergy Metabolism/*physiologyGlucose/*metabolismInjections, IntraventricularMaleNerve Growth Factors/*metabolismRatsRats, Inbred StrainsStreptozocin/administration & dosage/pharmacologySupport, Non-U.S. Gov'tJ Neurosci Res1992313479-86.(Hellweg et al. 1992).
These data clearly indicate that the perturbed function of the neuronal insulin receptor is of pivotal significance for the development of deficits in learning and memory capacities. This assumption seems to be in contrast to insulin receptor knockout experiments in which no alterations in basal brain glucose utilization and learning and memory capacities were found ADDIN EN.CITE Schubert200457980149812330027-8424 (Print)10192004Mar 2Role for neuronal insulin resistance in neurodegenerative diseases3100-5Institute for Genetics, University of Cologne, D-50931 Cologne, Germany.Schubert, M.Gautam, D.Surjo, D.Ueki, K.Baudler, S.Schubert, D.Kondo, T.Alber, J.Galldiks, N.Kustermann, E.Arndt, S.Jacobs, A. H.Krone, W.Kahn, C. R.Bruning, J. C.Proc Natl Acad Sci U S AAnimalsApoptosisBrain/pathology/ physiopathologyCerebellum/physiopathologyGlucose/metabolismInsulin Resistance/ physiologyMaze LearningMemory/physiologyMiceMice, KnockoutMotor ActivityNeurodegenerative Diseases/ physiopathologyNeurons/ physiologyReceptor, Insulin/deficiency/genetics/physiologyResearch Support, Non-U.S. Gov'tResearch Support, U.S. Gov't, P.H.S.Tomography, Emission-Computed(Schubert et al. 2004). However, it may have to be considered that the expression of the insulin-like growth factor-1 (IGF-1) receptor remained unaltered in the latter study indicating that an important compensation mechanism is intact. IGF-1 is an insulin homologue abundantly found in the developing brain ADDIN EN.CITE Rotwein19885631034224220027-84248511988JanDifferential expression of insulin-like growth factor genes in rat central nervous system265-9Department of Medicine, Washington University School of Medicine, St. Louis, MO 63110.Rotwein, P.Burgess, S. K.Milbrandt, J. D.Krause, J. E.Proc Natl Acad Sci U S AAgingAnimalsBrain/embryology/growth & development/ metabolismEmbryoEmbryonic and Fetal DevelopmentExonsGenes, StructuralInsulin-Like Growth Factor I/ geneticsInsulin-Like Growth Factor II/ geneticsRNA, Messenger/analysis/geneticsRatsRats, Inbred StrainsResearch Support, Non-U.S. Gov'tResearch Support, U.S. Gov't, P.H.S.Somatomedins/ geneticsTranscription, Genetic(Rotwein et al. 1988). The IGF-1 receptor is widely distributed in the brain ADDIN EN.CITE Adamo19895628025530690893-764831-21989Spring-SummerInsulin and insulin-like growth factor receptors in the nervous system71-100Section of Molecular and Cellular Physiology, NIDDK, Bethesda, MD 20892.Adamo, M.Raizada, M. K.LeRoith, D.Mol NeurobiolAnimalsBrain/cytology/growth & developmentBrain ChemistryInsulin/analysis/physiologyReceptor, Insulin/analysis/physiologyReceptors, Cell Surface/analysis/physiologyReceptors, SomatomedinResearch Support, Non-U.S. Gov'tSomatomedins/analysis/physiologyMarks19915633016628670065-25982931991Localization of insulin and type 1 IGF receptors in rat brain by in vitro autoradiography and in situ hybridization459-70Dept. of Biological Structure, University of Washington, Seattle.Marks, J. L.King, M. G.Baskin, D. G.Adv Exp Med BiolAnimalsAutoradiographyBrain Chemistry/ physiologyInsulin/ analysisNucleic Acid HybridizationRNA, Messenger/geneticsRatsReceptors, Cell Surface/ analysisReceptors, SomatomedinResearch Support, Non-U.S. Gov'tResearch Support, U.S. Gov't, Non-P.H.S.Research Support, U.S. Gov't, P.H.S.SomatomedinsMarks19915632016586380888-8809581991AugLocalization of type I insulin-like growth factor receptor messenger RNA in the adult rat brain by in situ hybridization1158-68Division of Endocrinology/Metabolism, Veterans Affairs Medical Center, Seattle, Washington 98108.Marks, J. L.Porte, D., Jr.Baskin, D. G.Mol EndocrinolAnimalsAutoradiographyBlotting, NorthernBrain ChemistryComparative StudyFemaleInsulin-Like Growth Factor I/metabolismNucleic Acid HybridizationOligonucleotide ProbesRNA, Messenger/ analysisRatsRats, Inbred StrainsReceptors, Cell Surface/ genetics/metabolismReceptors, SomatomedinResearch Support, Non-U.S. Gov'tResearch Support, U.S. Gov't, Non-P.H.S.Research Support, U.S. Gov't, P.H.S.Tissue Distribution(Adamo et al. 1989; Marks et al. 1991b; Marks et al. 1991a). The IGF-1 receptor and the insulin receptor are also found to be homologous with nearly identical signal-transducing domains controlling most of the same intracellular pathways ADDIN EN.CITE De Meyts19945634078680680301-0163424-51994The insulin-like growth factor-I receptor. Structure, ligand-binding mechanism and signal transduction152-69Hagedorn Research Institute, Gentofte, Denmark.De Meyts, P.Wallach, B.Christoffersen, C. T.Urso, B.Gronskov, K.Latus, L. J.Yakushiji, F.Ilondo, M. M.Shymko, R. M.Horm ResAnimalsBinding SitesCa(2+)-Calmodulin Dependent Protein Kinase/metabolismHumansKineticsLigandsModels, MolecularMolecular StructureProtein Structure, TertiaryProtein-Tyrosine Kinase/metabolismReceptor, IGF Type 1/ chemistry/metabolismReceptor, Insulin/chemistry/metabolismSignal Transductionras Proteins/metabolism(De Meyts et al. 1994). IGF-1 peaks during postnatal development only and is barely detected in normal adult brain ADDIN EN.CITE Rotwein19885631034224220027-84248511988JanDifferential expression of insulin-like growth factor genes in rat central nervous system265-9Department of Medicine, Washington University School of Medicine, St. Louis, MO 63110.Rotwein, P.Burgess, S. K.Milbrandt, J. D.Krause, J. E.Proc Natl Acad Sci U S AAgingAnimalsBrain/embryology/growth & development/ metabolismEmbryoEmbryonic and Fetal DevelopmentExonsGenes, StructuralInsulin-Like Growth Factor I/ geneticsInsulin-Like Growth Factor II/ geneticsRNA, Messenger/analysis/geneticsRatsRats, Inbred StrainsResearch Support, Non-U.S. Gov'tResearch Support, U.S. Gov't, P.H.S.Somatomedins/ geneticsTranscription, GeneticCheng200056350109547330027-842497182000Aug 29Insulin-like growth factor 1 regulates developing brain glucose metabolism10236-41Developmental Endocrinology Branch, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD 20892, USA.Cheng, C. M.Reinhardt, R. R.Lee, W. H.Joncas, G.Patel, S. C.Bondy, C. A.Proc Natl Acad Sci U S AAnimalsBrain/drug effects/growth & development/ physiologyCa(2+)-Calmodulin Dependent Protein Kinase/metabolismDeoxyglucose/ pharmacokineticsGene Expression RegulationGlucose/ metabolismGlycogen/biosynthesisGlycogen Synthase Kinase 3Glycogen Synthase KinasesInsulin-Like Growth Factor I/deficiency/genetics/pharmacology/ physiologyMaleMiceMice, KnockoutMicrotubule-Associated Proteins/genetics/metabolismMonosaccharide Transport Proteins/genetics/metabolismMuscle ProteinsNeurons/ physiologyPhosphorylationProtein-Serine-Threonine KinasesProto-Oncogene Proteins/metabolismRatsRats, Sprague-DawleySignal TransductionTranscription, Genetic(Rotwein et al. 1988; Cheng et al. 2000). It is, however, highly induced in glia cells reacting to damage ADDIN EN.CITE Lee19935636076823000306-45225311993MarLocalization of insulin-like growth factor binding protein-2 messenger RNA during postnatal brain development: correlation with insulin-like growth factors I and II251-65Developmental Endocrinology Branch, National Institute of Child Health and Human Development, Bethesda, MD 20892.Lee, W. H.Michels, K. M.Bondy, C. A.NeuroscienceAnimalsAstrocytes/metabolismAutoradiographyBrain/anatomy & histology/ growth & developmentBrain Chemistry/ physiologyCarrier Proteins/ biosynthesisDenervationFemaleGene ExpressionGlial Fibrillary Acidic Protein/biosynthesisImmunohistochemistryIn Situ HybridizationInsulin-Like Growth Factor Binding Protein 2Insulin-Like Growth Factor I/ biosynthesisInsulin-Like Growth Factor II/ biosynthesisPregnancyRNA, Messenger/ analysis/metabolismRatsRats, Sprague-DawleyResearch Support, Non-U.S. Gov'tResearch Support, U.S. Gov't, P.H.S.(Lee et al. 1993). After STZ icv administration, IGF-1 receptor gene expression was found to be reduced ADDIN EN.CITE Grünblatt200453400Grünblatt, E.Hoyer, S.Riederer, P.2004Gene expression profile in streptozotocin rat model for sporadic Alzheimer's diseaseJ Neural Transm1113367-86Mar14991460Department of Neurochemistry, Clinic for Psychiatry and Psychotherapy, University of Wurzburg, Wurzburg, Germany.(Grnblatt et al. 2004).
To study the mode of action of STZ icv to brain cells, two different drugs, 5-thio-D-glucose 3-0-methyl glucose, well-known as glucose transport inhibitors, were administered icv. In line with the fact of STZ entering beta cells by GLUT2, systemic administration of these drugs immediately before STZ has been reported to prevent STZ-induced beta-cell toxicity and diabetes ADDIN EN.CITE Ganda1976579901323820012-1797 (Print)2571976JulStudies on streptozotocin diabetes595-603Ganda, O. P.Rossini, A. A.Like, A. A.DiabetesAlloxan/antagonists & inhibitors/pharmacologyAnimalsBlood Glucose/metabolismDeoxy Sugars/ pharmacologyDeoxyglucose/ pharmacologyDiabetes Mellitus/blood/ chemically induced/prevention & controlDiabetes Mellitus, Experimental/prevention & controlDisease Models, AnimalGlucose/ pharmacologyIslets of Langerhans/drug effectsMaleMannoheptulose/pharmacologyMannose/ pharmacologyMethylglucosides/ pharmacologyMethylglycosides/ pharmacologyRatsResearch Support, U.S. Gov't, P.H.S.Streptozocin/antagonists & inhibitors/pharmacologyStructure-Activity RelationshipTime FactorsWang19935800084324130012-1797 (Print)4231993MarPrevention of high- and low-dose STZ-induced diabetes with D-glucose and 5-thio-D-glucose420-8Clinical Department, Heinrich-Heine-University of Dusseldorf, Germany.Wang, Z.Dohle, C.Friemann, J.Green, B. S.Gleichmann, H.DiabetesAnimalsDiabetes Mellitus, Experimental/ prevention & controlDose-Response Relationship, DrugGlucose/ analogs & derivatives/ pharmacologyHyperglycemia/prevention & controlInjections, IntraperitonealIslets of Langerhans/drug effectsMaleMiceMice, Inbred BALB CMice, Inbred C57BLResearch Support, Non-U.S. Gov'tStreptozocin/ antagonists & inhibitors(Ganda et al. 1976; Wang et al. 1993). Analogously, we have hypothesized that glucose transport inhibitor icv pre-treatment may avoid STZ transport into the particular brain cells, and learning and memory capacities served as a sensitive marker of STZ-induced damage. Surprisingly, icv pre-treatment with two different glucose transport inhibitors did not abolish the STZ-induced effect on mental capacities which was found to be reduced with STZ icv treatment alone (Fig. 4), suggesting some differences between the peripheral and central (icv) mechanism(s) of STZ cytotoxicity. This hypothesis has been further supported by the fact that although GLUT2 has been demonstrated to be highly expressed in the hypothalamus what would expect severe damage after STZ icv in this area, the STZ-induced damage on gene expression in this study was found to be lowest in hypothalamus relative to frontoparietal brain cortex and hippocampus (Fig. 1 and 2). Since the direct evidence of STZ either entering the particular brain cells via GLUT2 or its CNS cytotoxicity being strictly dependent on GLUT2 type of glucose transporter expression (as reported for the pancreatic islet toxicity of STZ; ADDIN EN.CITE Hosokawa200158220117413070006-291X (Print)28952001Dec 21Differential sensitivity of GLUT1- and GLUT2-expressing beta cells to streptozotocin1114-7Institute of Pharmacology and Toxicology, 27, rue du Bugnon, Lausanne, CH-1005, Switzerland.Hosokawa, M.Dolci, W.Thorens, B.Biochem Biophys Res CommunAnimalsBlood Glucose/metabolismCell Survival/drug effectsComparative StudyDrug ResistanceGene ExpressionGlucose Transporter Type 1Glucose Transporter Type 2HumansHyperglycemia/chemically induced/genetics/metabolismIn VitroInsulin/genetics/metabolismIslets of Langerhans/cytology/ drug effects/ metabolismMaleMiceMice, Inbred C57BLMice, KnockoutMonosaccharide Transport Proteins/genetics/ metabolismPromoter Regions (Genetics)RatsResearch Support, Non-U.S. Gov'tSpecies SpecificityStreptozocin/ toxicity(Hosokawa et al. 2001) is lacking, interpretation of glucose transport inhibitor pre-treatment failure in abolishing STZ icv induced effects could be only a speculative one. Theoretically, 3OMG and TG may also inhibit glucose uptake in all brain cells expressing any type of glucose transporters leading to extensive intracellular glucose deprivation. Such condition could be manifested as cognitive deficits, masking thus 3OMG and TG pre-treatment induced abolishing of STZ icv associated cognitive deficits, if such abolishment happened. However, there is no information from the literature that these two substances inhibit all glucose transporter types.
Regionally specific character of brain neurochemical alterations following the STZ icv administration has been convincingly reported at various levels; IR signaling ADDIN EN.CITE Salkovic-Petrisic200656700164120930022-3042 (Print)9642006FebAlzheimer-like changes in protein kinase B and glycogen synthase kinase-3 in rat frontal cortex and hippocampus after damage to the insulin signalling pathway1005-15Department of Pharmacology and Croatian Institute for Brain Research, School of Medicine, University of Zagreb, Zagreb, Croatia.Salkovic-Petrisic, M.Tribl, F.Schmidt, M.Hoyer, S.Riederer, P.J Neurochem(Salkovic-Petrisic et al. 2006), glucose utilization ADDIN EN.CITE Duelli19948080Intracerebroventricular injection of streptozotocin induces discrete local changes in cerebral glucose utilization in ratsDuelli, R.Schrock, H.Kuschinsky, W.Hoyer, S.AnimalBrain/*metabolismDisease Models, AnimalFrontal Lobe/metabolismGlucose/*metabolismHemodynamicsInjections, SpinalMaleRatsRats, WistarReceptor, Insulin/metabolismStreptozocin/*pharmacologySupport, Non-U.S. Gov'tInt J Dev Neurosci1994128737-43.(Duelli et al. 1994), monoaminergic transmission ADDIN EN.CITE Salkovic-Petrisic200336570Intracerebroventricular administration of betacytotoxics alters expression of brain monoamine transporter genesSalkovic-Petrisic, M.Lackovic, Z.J Neural Transm2003110115-29.Salkovic199553370896268310021995Striatal dopaminergic D1 and D2 receptors after intracerebroventricular application of alloxan and streptozocin in rat137-45Department of Pharmacology, Medical School, University of Zagreb, Croatia.Salkovic, M.Sabolic, I.Lackovic, Z.J Neural Transm Gen SectAlloxan/ pharmacologyAnimalsCorpus Striatum/ metabolismGTP-Binding Proteins/metabolismInjections, IntraventricularMaleRatsRats, WistarReceptors, Dopamine D1/ metabolismReceptors, Dopamine D2/ metabolismStreptozocin/ pharmacology(Salkovic et al. 1995; Salkovic-Petrisic and Lackovic 2003), suggesting they are not a consequence of a general, non-specific toxicity of STZ. This is further supported by regionally specific (and partly overlapping) distribution of structures that are known or assumed to be its target (GLUT2 and IR).
Otherwise, STZ icv has been shown to cause broad effects on metabolic pathways being under control of the neuronal insulin receptor allowing detailed studies on the pathophysiology of the insulin/insulin receptor-dependent metabolism (see introduction). Recent findings clearly demonstrated that STZ icv application caused the down regulation of gene expression related to insulin signalling such as IGF-1 receptor. In contrast to this down regulation, an up regulation was found in gene expression related to potassium channels, GABA receptors and glutamate receptors ADDIN EN.CITE Grünblatt200453400Grünblatt, E.Hoyer, S.Riederer, P.2004Gene expression profile in streptozotocin rat model for sporadic Alzheimer's diseaseJ Neural Transm1113367-86Mar14991460Department of Neurochemistry, Clinic for Psychiatry and Psychotherapy, University of Wurzburg, Wurzburg, Germany.(Grnblatt et al. 2004). Genes such as GDNF, BDNF and integrin-alpha-M were up regulated whereas immediate-early-gene-transcription-factor NGF-IB and methallothionein-1/2 were found to be down-regulated demonstrating that transcription and inflammatory factors, apoptosis inducers, cell survival and oxidative stress-involving proteins are altered ADDIN EN.CITE Grünblatt200658000Grünblatt, EKoutsilieri, EHoyer, SRiederer, P2006Gene expression alterations in brain areas of intracerebroventricular streptozotocin treated ratJ Alzheimers DisIn Press(Grnblatt et al. 2006). This view is supported by the activation of the markers of oxidative cell damage ADDIN EN.CITE Ishrat200658010166210540166-4328 (Print)17112006Jul 15Coenzyme Q10 modulates cognitive impairment against intracerebroventricular injection of streptozotocin in rats9-16Neurotoxicology Laboratory, Department of Medical Elementology and Toxicology, Jamia Hamdard (Hamdard University), New Delhi, India.Ishrat, T.Khan, M. B.Hoda, M. N.Yousuf, S.Ahmad, M.Ansari, M. A.Ahmad, A. S.Islam, F.Behav Brain Res(Ishrat et al. 2006). As a consequence of the STZ icv-induced cascade of genetic and metabolic abnormalities, neuronal damage and loss may develop accompanied by an astrocytic rescue reaction ADDIN EN.CITE Lester-Coll200657970166279311387-2877 (Print)912006MarIntracerebral streptozotocin model of type 3 diabetes: relevance to sporadic Alzheimer's disease13-33Department of Medicine, Rhode Island Hospital and Brown Medical School, Providence, RI 02903, USA.Lester-Coll, N.Rivera, E. J.Soscia, S. J.Doiron, K.Wands, J. R.de la Monte, S. M.J Alzheimers Dis(Lester-Coll et al. 2006).
This study shows a marked dis s o c i a t i o n b e t w e e n s e v e r e l y r e d u c e d I R m R N A i n f r o n t o p a r i e t a l b r a i n c o r t e x a n d h i p p o c a m p u s , a n d n e a r l y u n c h a n g e d c o n c e n t r a t i o n s o f I R - s u b u n i t i n t h e s e a r e a s . L i k e w i s e , u n c h a n g e d o r e v e n e l e v a t e d p h o s p h o r y l a t i o n o f t h e I R t y r o s i n e r e s i d u e s a n d P T K a c t i v i t y became obvious. These unexpected findings may point to imbalances between the generation of proteins and their turnover and between protein phosphorylation and dephosphorylation under pathological conditions. Receptor proteins localized postsynaptically may undergo changes of synaptic plasticity, i.e. change from a labile to a stable or even regressed state, the latter being nearly unable to transmit impulses ADDIN EN.CITE Changeux1976580501891950028-0836 (Print)26455881976Dec 23-30Selective stabilisation of developing synapses as a mechanism for the specification of neuronal networks705-12Changeux, J. P.Danchin, A.NatureAcetylcholine/metabolismAnimalsCerebellum/cytology/embryology/ growth & developmentGenesModels, NeurologicalMotor Endplate/metabolismMuscle DenervationNerve Net/ growth & developmentNervous System/ growth & developmentNeural Pathways/embryology/ growth & developmentNeuromuscular Junction/drug effects/embryology/ growth & developmentReceptors, Cholinergic/drug effects/metabolismSnake Venoms/pharmacologySynapses/ physiologySynaptic Transmission(Changeux and Danchin 1976). It is not clear as yet in which way and to what degree this process influences the turnover of the IR protein. There is also some evidence that failing receptor dephosphorylation may inhibit autophosphorylation activity ADDIN EN.CITE Lai19895806025924040021-9525 (Print)1096 Pt 11989DecLigand-mediated autophosphorylation activity of the epidermal growth factor receptor during internalization2751-60Department of Anatomy, McGill University, Montreal, Quebec, Canada.Lai, W. H.Cameron, P. H.Doherty, J. J., 2ndPosner, B. I.Bergeron, J. J.J Cell BiolAnimalsAutoradiographyEndocytosisEpidermal Growth Factor/metabolism/ pharmacologyIodine RadioisotopesKineticsLigandsLiver/ metabolismMalePhosphorylationRatsRats, Inbred StrainsReceptor, Epidermal Growth Factor/drug effects/ metabolismReference ValuesResearch Support, Non-U.S. Gov'tResearch Support, U.S. Gov't, P.H.S.(Lai et al. 1989), and that, with time, tyrosine-phosphorylated receptors become inaccessible to phosphatases, therefore allowing persistence of tyrosine kinase activity ADDIN EN.CITE Paolini19965807086632410021-9258 (Print)271271996Jul 5Persistence of tyrosine-phosphorylated FcepsilonRI in deactivated cells15987-92Molecular Allergy and Immunology Section, NIAID, National Institutes of Health, Rockville, Maryland 20852, USA.Paolini, R.Serra, A.Kinet, J. P.J Biol ChemAdenosine Triphosphate/metabolismAnimalsAntigensElectrophoresis, Polyacrylamide GelEnzyme ActivationEnzyme Precursors/metabolismHaptensKineticsLeukemia, Basophilic, AcuteMacromolecular SubstancesPeptide Fragments/chemistry/isolation & purificationPeptide MappingPhosphopeptides/chemistry/isolation & purificationPhosphorylationPhosphotyrosineProtein-Tyrosine Kinase/metabolismRatsReceptors, IgE/ chemistry/isolation & purification/ metabolismSerotonin/metabolismTumor Cells, Cultured(Paolini et al. 1996).
Indeed, the activity of the protein tyrosine phosphatase decreased after long-term STZ-damage ADDIN EN.CITE Meyerovitch198910340Hepatic phosphotyrosine phosphatase activity and its alterations in diabetic ratsMeyerovitch, J.Backer, J. M.Kahn, C. R.AnimalCytosol/enzymologyDiabetes Mellitus, Experimental/drug therapy/*enzymology/physiopathologyDiabetes Mellitus, Insulin-Dependent/drugtherapy/enzymology/physiopathologyInsulin/therapeutic useLiver/*enzymology/physiopathologyMalePhosphoprotein Phosphatase/*metabolismPhosphorylationProtein-Tyrosine-PhosphataseRatsRats, Inbred BBRats, Inbred StrainsReceptor, Insulin/metabolismSupport, Non-U.S. Gov'tSupport, U.S. Gov't, P.H.S.Vanadates/therapeutic useJ Clin Invest1989843976-83.(Meyerovitch et al. 1989), and induced a drastic reduction of IR dephosphorylation ADDIN EN.CITE Begum199110440Differential effects of diabetes on adipocyte and liver phosphotyrosine and phosphoserine phosphatase activitiesBegum, N.Sussman, K. E.Draznin, B.Adipose Tissue/drug effects/*enzymologyAnimalComparative StudyCytosol/enzymologyDiabetes Mellitus, Experimental/drug therapy/*enzymologyEthers, Cyclic/pharmacologyGlycogen Synthase/metabolismInsulin/therapeutic useKineticsLiver/drug effects/*enzymologyMacromolecular SystemsMaleOkadaic AcidPhosphoric Monoester Hydrolases/*metabolismProtein-Tyrosine-Phosphatase/*metabolismRatsRats, Inbred StrainsReceptor, Insulin/metabolismReference ValuesSupport, Non-U.S. Gov'tSupport, U.S. Gov't, Non-P.H.S.Vanadates/pharmacologyDiabetes199140121620-9.(Begum et al. 1991). Thus, the diminished activity of the protein tyrosine phosphatase may be assumed to reduce dephosphorylation of the tyrosine residues of the IR-( subunit and may render it insufficient in function by inhibition of autophosphorylation, whereby regional differences may come into play in frontoparietal brain cortex and hippocampus. Alternatively, since a significant increase in brain insulin receptor kinase activity has been found in diabetic rat brain, it has been hypothesized that brain insulin receptor kinase may be regulated differently compared to peripheral tissue ADDIN EN.CITE Gupta19925802013390200197-0186 (Print)2041992JunModulation of rat brain insulin receptor kinase activity in diabetes487-92Hormone and Drug Research Laboratory, School of Life Sciences, Jawaharlal Nehru University, New Delhi, India.Gupta, G.Azam, M.Baquer, N. Z.Neurochem IntAnimalsBrain/ metabolismDiabetes Mellitus, Experimental/blood/ metabolismInsulin/blood/metabolismMalePhosphotransferases/ metabolismRatsRats, WistarReceptor, Insulin/ metabolism(Gupta et al. 1992). However, increased protein tyrosine kinase activity does not necessarily lead to increased IR signal transduction throughout the cell, if intracellular downstream pathway signaling elements are affected, as found after STZ icv treatment in PI3 kinase pathway, at the level of Akt/PKB and GSK-3 ADDIN EN.CITE Salkovic-Petrisic200656700164120930022-3042 (Print)9642006FebAlzheimer-like changes in protein kinase B and glycogen synthase kinase-3 in rat frontal cortex and hippocampus after damage to the insulin signalling pathway1005-15Department of Pharmacology and Croatian Institute for Brain Research, School of Medicine, University of Zagreb, Zagreb, Croatia.Salkovic-Petrisic, M.Tribl, F.Schmidt, M.Hoyer, S.Riederer, P.J Neurochem(Salkovic-Petrisic et al. 2006). Further detailed studies are needed to clarify this issue e.g. the release of the ( subunit of the IR from the cellular membrane into the cytosol and the determination of protein phosphatases activity after STZ.
Bearing in mind that STZ icv treated rats have been proposed as a probable experimental model of SAD, one could hypothesized that induction of disturbances in the brain insulin system including insulin receptor signalling may be assumed to be the core of abnormalities tightly related to SAD, i.e. intracellular fibrillary tangles with hyperphosphorylated tau protein and extracellular deposits of neuritic plaques with (-amyloids (A().
In a recent investigation, both the over production of tau-protein and the accumulation of A( in leptomeningal vessels could be demonstrated after STZ icv ADDIN EN.CITE Lester-Coll200657970166279311387-2877 (Print)912006MarIntracerebral streptozotocin model of type 3 diabetes: relevance to sporadic Alzheimer's disease13-33Department of Medicine, Rhode Island Hospital and Brown Medical School, Providence, RI 02903, USA.Lester-Coll, N.Rivera, E. J.Soscia, S. J.Doiron, K.Wands, J. R.de la Monte, S. M.J Alzheimers Dis(Lester-Coll et al. 2006). In this study we showed, in addition, that tau-protein is hyperphosphrylated as a long-term consequence of STZ icv administration (Fig. 3). The intracerebral application of STZ in a higher dosage than used in our study caused neuronal damage and cell loss as well as the accumulation of A( in the brain of pups ADDIN EN.CITE Lester-Coll200657970166279311387-2877 (Print)912006MarIntracerebral streptozotocin model of type 3 diabetes: relevance to sporadic Alzheimer's disease13-33Department of Medicine, Rhode Island Hospital and Brown Medical School, Providence, RI 02903, USA.Lester-Coll, N.Rivera, E. J.Soscia, S. J.Doiron, K.Wands, J. R.de la Monte, S. M.J Alzheimers Dis(Lester-Coll et al. 2006). Bearing in mind the former data comprising abnormalities in glucose/energy metabolism, acetylcholine formation and function, insulin signal transduction and learning and memory capacities, it seems likely that induction of the brain insulin system dysfunction may be relevant for the beginning of SAD. Further research is needed to clarify this hypothesis.
Acknowledgment
The authors thank the funding that has been provided by the Alzheimer Forschung Initiative e.V, DAAD (project No. A/04/20017), the Dr. Edda Neele Stiftung, and the Croatian Ministry of Science, Education and Sport (project No. 0108253). Prof. Dr. E-M Mandelkow is thanked for tau protein antibody donation. Special thank to Miss Miryame Hofmann for her efficient and exact work in providing these great results. Mrs Bozica Hrzan is thanked for technical assistance.
References
QUOTE EN.REFLIST Abbott M. A., Wells D. G. and Fallon J. R. (1999) The insulin receptor tyrosine kinase substrate p58/53 and the insulin receptor are components of CNS synapses. J Neurosci 19, 7300-7308.
Adamo M., Raizada M. K. and LeRoith D. (1989) Insulin and insulin-like growth factor receptors in the nervous system. Mol Neurobiol 3, 71-100.
Anger W. K. (1991) Animal test systems to study behavioral dysfunctions of neurodegenerative disorders. Neurotoxicology 12, 403-413.
Arluison M., Quignon M., Thorens B., Leloup C. and Penicaud L. (2004a) Immunocytochemical localization of the glucose transporter 2 (GLUT2) in the adult rat brain. II. Electron microscopic study. J Chem Neuroanat 28, 137-146.
Arluison M., Quignon M., Nguyen P., Thorens B., Leloup C. and Penicaud L. (2004b) Distribution and anatomical localization of the glucose transporter 2 (GLUT2) in the adult rat brain--an immunohistochemical study. J Chem Neuroanat 28, 117-136.
Ar'Rajab A. and Ahren B. (1993) Long-term diabetogenic effect of streptozotocin in rats. Pancreas 8, 50-57.
Avruch J. (1998) Insulin signal transduction through protein kinase cascades. Mol Cell Biochem 182, 31-48.
Banks W. A. (2004) The source of cerebral insulin. Eur J Pharmacol 490, 5-12.
Baskin D. G., Schwartz M. W., Sipols A. J., D'Alessio D. A., Goldstein B. J. and White M. F. (1994) Insulin receptor substrate-1 (IRS-1) expression in rat brain. Endocrinology 134, 1952-1955.
Begum N., Sussman K. E. and Draznin B. (1991) Differential effects of diabetes on adipocyte and liver phosphotyrosine and phosphoserine phosphatase activities. Diabetes 40, 1620-1629.
Blokland A. and Jolles J. (1993) Spatial learning deficit and reduced hippocampal ChAT activity in rats after an ICV injection of streptozotocin. Pharmacol Biochem Behav 44, 491-494.
Blondel O. and Portha B. (1989) Early appearance of in vivo insulin resistance in adult streptozotocin-injected rats. Diabete Metab 15, 382-387.
Bradford M. M. (1976) Rapid and sensitive method for quantitation of microgram quantities of proteins utilizing principle of protein dye binding. Anal Biochem 72, 248-254.
Brant A. M., Jess T. J., Milligan G., Brown C. M. and Gould G. W. (1993) Immunological analysis of glucose transporters expressed in different regions of the rat brain and central nervous system. Biochem Biophys Res Commun 192, 1297-1302.
Changeux J. P. and Danchin A. (1976) Selective stabilisation of developing synapses as a mechanism for the specification of neuronal networks. Nature 264, 705-712.
Cheng C. M., Reinhardt R. R., Lee W. H., Joncas G., Patel S. C. and Bondy C. A. (2000) Insulin-like growth factor 1 regulates developing brain glucose metabolism. Proc Natl Acad Sci U S A 97, 10236-10241.
Combettes-Souverain M. and Issad T. (1998) Molecular basis of insulin action. Diabetes Metab 24, 477-489.
De Meyts P., Wallach B., Christoffersen C. T., Urso B., Gronskov K., Latus L. J., Yakushiji F., Ilondo M. M. and Shymko R. M. (1994) The insulin-like growth factor-I receptor. Structure, ligand-binding mechanism and signal transduction. Horm Res 42, 152-169.
Devaskar S. U., Giddings S. J., Rajakumar P. A., Carnaghi L. R., Menon R. K. and Zahm D. S. (1994) Insulin gene expression and insulin synthesis in mammalian neuronal cells. J Biol Chem 269, 8445-8454.
Duelli R., Schrock H., Kuschinsky W. and Hoyer S. (1994) Intracerebroventricular injection of streptozotocin induces discrete local changes in cerebral glucose utilization in rats. Int J Dev Neurosci 12, 737-743.
Frlich L., Blum-Degen D., Bernstein H. G., Engelsberger S., Humrich J., Laufer S., Muschner D., Thalheimer A., Turk A., Hoyer S., Zochling R., Boissl K. W., Jellinger K. and Riederer P. (1998) Brain insulin and insulin receptors in aging and sporadic Alzheimer's disease. J Neural Transm 105, 423-438.
Ganda O. P., Rossini A. A. and Like A. A. (1976) Studies on streptozotocin diabetes. Diabetes 25, 595-603.
Giorgino F., Chen J. H. and Smith R. J. (1992) Changes in tyrosine phosphorylation of insulin receptors and a 170,000 molecular weight nonreceptor protein in vivo in skeletal muscle of streptozotocin-induced diabetic rats: effects of insulin and glucose. Endocrinology 130, 1433-1444.
Goldstein B. J. (1993) Regulation of insulin receptor signaling by protein-tyrosine dephosphorylation. Receptor 3, 1-15.
Grnblatt E., Hoyer S. and Riederer P. (2004) Gene expression profile in streptozotocin rat model for sporadic Alzheimer's disease. J Neural Transm 111, 367-386.
Grnblatt E., Koutsilieri E., Hoyer S. and Riederer P. (2006) Gene expression alterations in brain areas of intracerebroventricular streptozotocin treated rat. J Alzheimers Dis In Press.
Gupta G., Azam M. and Baquer N. Z. (1992) Modulation of rat brain insulin receptor kinase activity in diabetes. Neurochem Int 20, 487-492.
Hring H. U. (1991) The insulin receptor: signalling mechanism and contribution to the pathogenesis of insulin resistance. Diabetologia 34, 848-861.
Hellweg R., Nitsch R., Hock C., Jaksch M. and Hoyer S. (1992) Nerve growth factor and choline acetyltransferase activity levels in the rat brain following experimental impairment of cerebral glucose and energy metabolism. J Neurosci Res 31, 479-486.
Holness M. J., Langdown M. L. and Sugden M. C. (2000) Early-life programming of susceptibility to dysregulation of glucose metabolism and the development of Type 2 diabetes mellitus. Biochem J 349, 657-665.
Hosokawa M., Dolci W. and Thorens B. (2001) Differential sensitivity of GLUT1- and GLUT2-expressing beta cells to streptozotocin. Biochem Biophys Res Commun 289, 1114-1117.
Hoyer S. (1985) The effect of age on glucose and energy metabolism in brain cortex of rats. Arch Gerontol Geriatr 4, 193-203.
Hoyer S. (1998) Is sporadic Alzheimer disease the brain type of non-insulin dependent diabetes mellitus? A challenging hypothesis. J Neural Transm 105, 415-422.
Hoyer S. (2002) The brain insulin signal transduction system and sporadic (type II) Alzheimer disease: an update. J Neural Transm 109, 341-360.
Hoyer S. (2004) Glucose metabolism and insulin receptor signal transduction in Alzheimer disease. Eur J Pharmacol 490, 115-125.
Hoyer S. and Frlich L. (2006) Brain function and insulin signal transduction in sporadic Alzheimer's disease, in Research Progress in Alzheimer's Disease and Dementia, Vol. In Press (Sun M. K., ed.). Nova Science, New York.
Hoyer S., Nitsch R. and Oesterreich K. (1991) Predominant abnormality in cerebral glucose utilization in late-onset dementia of the Alzheimer type: a cross-sectional comparison against advanced late-onset and incipient early-onset cases. J Neural Transm Park Dis Dement Sect 3, 1-14.
Ishrat T., Khan M. B., Hoda M. N., Yousuf S., Ahmad M., Ansari M. A., Ahmad A. S. and Islam F. (2006) Coenzyme Q10 modulates cognitive impairment against intracerebroventricular injection of streptozotocin in rats. Behav Brain Res 171, 9-16.
Kadowaki T., Kasuga M., Akanuma Y., Ezaki O. and Takaku F. (1984) Decreased autophosphorylation of the insulin receptor-kinase in streptozotocin-diabetic rats. J Biol Chem 259, 14208-14216.
Kenner K. A., Hill D. E., Olefsky J. M. and Kusari J. (1993) Regulation of protein tyrosine phosphatases by insulin and insulin-like growth factor I. J Biol Chem 268, 25455-25462.
Krncke K. D., Fehsel K., Sommer A., Rodriguez M. L. and Kolb-Bachofen V. (1995) Nitric oxide generation during cellular metabolization of the diabetogenic N-methyl-N-nitroso-urea streptozotozin contributes to islet cell DNA damage. Biol Chem Hoppe Seyler 376, 179-185.
Lai W. H., Cameron P. H., Doherty J. J., 2nd, Posner B. I. and Bergeron J. J. (1989) Ligand-mediated autophosphorylation activity of the epidermal growth factor receptor during internalization. J Cell Biol 109, 2751-2760.
Lannert H. and Hoyer S. (1998) Intracerebroventricular administration of streptozotocin causes long-term diminutions in learning and memory abilities and in cerebral energy metabolism in adult rats. Behav Neurosci 112, 1199-1208.
Lee W. H., Michels K. M. and Bondy C. A. (1993) Localization of insulin-like growth factor binding protein-2 messenger RNA during postnatal brain development: correlation with insulin-like growth factors I and II. Neuroscience 53, 251-265.
Leloup C., Arluison M., Lepetit N., Cartier N., Marfaing-Jallat P., Ferre P. and Penicaud L. (1994) Glucose transporter 2 (GLUT 2): expression in specific brain nuclei. Brain Res 638, 221-226.
Lester-Coll N., Rivera E. J., Soscia S. J., Doiron K., Wands J. R. and de la Monte S. M. (2006) Intracerebral streptozotocin model of type 3 diabetes: relevance to sporadic Alzheimer's disease. J Alzheimers Dis 9, 13-33.
Li B., Xi X., Roane D. S., Ryan D. H. and Martin R. J. (2003) Distribution of glucokinase, glucose transporter GLUT2, sulfonylurea receptor-1, glucagon-like peptide-1 receptor and neuropeptide Y messenger RNAs in rat brain by quantitative real time RT-PCR. Brain Res Mol Brain Res 113, 139-142.
Marks J. L., Porte D., Jr. and Baskin D. G. (1991a) Localization of type I insulin-like growth factor receptor messenger RNA in the adult rat brain by in situ hybridization. Mol Endocrinol 5, 1158-1168.
Marks J. L., King M. G. and Baskin D. G. (1991b) Localization of insulin and type 1 IGF receptors in rat brain by in vitro autoradiography and in situ hybridization. Adv Exp Med Biol 293, 459-470.
Mayer G., Nitsch R. and Hoyer S. (1990) Effects of changes in peripheral and cerebral glucose metabolism on locomotor activity, learning and memory in adult male rats. Brain Res 532, 95-100.
Meyerovitch J., Backer J. M. and Kahn C. R. (1989) Hepatic phosphotyrosine phosphatase activity and its alterations in diabetic rats. J Clin Invest 84, 976-983.
Moss A. M., Unger J. W., Moxley R. T. and Livingston J. N. (1990) Location of phosphotyrosine-containing proteins by immunocytochemistry in the rat forebrain corresponds to the distribution of the insulin receptor. Proc Natl Acad Sci U S A 87, 4453-4457.
Ngarmukos C., Baur E. L. and Kumagai A. K. (2001) Co-localization of GLUT1 and GLUT4 in the blood-brain barrier of the rat ventromedial hypothalamus. Brain Res 900, 1-8.
Nitsch R. and Hoyer S. (1991) Local action of the diabetogenic drug, streptozotocin, on glucose and energy metabolism in rat brain cortex. Neurosci Lett 128, 199-202.
Noble E. P., Wurtman R. J. and Axelrod J. (1967) A simple and rapid method for injecting H3-norepinephrine into the lateral ventricle of the rat brain. Life Sci 6, 281-291.
Paolini R., Serra A. and Kinet J. P. (1996) Persistence of tyrosine-phosphorylated FcepsilonRI in deactivated cells. J Biol Chem 271, 15987-15992.
Park C. R., Seeley R. J., Craft S. and Woods S. C. (2000) Intracerebroventricular insulin enhances memory in a passive-avoidance task. Physiol Behav 68, 509-514.
Plaschke K. and Hoyer S. (1993) Action of the diabetogenic drug streptozotocin on glycolytic and glycogenolytic metabolism in adult rat brain cortex and hippocampus. Int J Dev Neurosci 11, 477-483.
Plata-Salaman C. R. (1991) Insulin in the cerebrospinal fluid. Neurosci Biobehav Rev 15, 243-258.
Raizada M. K., Shemer J., Judkins J. H., Clarke D. W., Masters B. A. and LeRoith D. (1988) Insulin receptors in the brain: structural and physiological characterization. Neurochem Res 13, 297-303.
Rajab A. A., Ahren B. and Bengmark S. (1989) Islet transplantation to the renal subcapsular space in streptozotocin-diabetic rats: short-term effects on glucose-stimulated insulin secretion. Diabetes Res Clin Pract 7, 197-204.
Rotwein P., Burgess S. K., Milbrandt J. D. and Krause J. E. (1988) Differential expression of insulin-like growth factor genes in rat central nervous system. Proc Natl Acad Sci U S A 85, 265-269.
Salkovic M., Sabolic I. and Lackovic Z. (1995) Striatal dopaminergic D1 and D2 receptors after intracerebroventricular application of alloxan and streptozocin in rat. J Neural Transm Gen Sect 100, 137-145.
Salkovic-Petrisic M. and Lackovic Z. (2003) Intracerebroventricular administration of betacytotoxics alters expression of brain monoamine transporter genes. J Neural Transm 110, 15-29.
Salkovic-Petrisic M. and Lackovic Z. (2005) Insulin resistant brain state and its link to diabetes mellitus. Period. Biol. 107, 137-146.
Salkovic-Petrisic M., Tribl F., Schmidt M., Hoyer S. and Riederer P. (2006) Alzheimer-like changes in protein kinase B and glycogen synthase kinase-3 in rat frontal cortex and hippocampus after damage to the insulin signalling pathway. J Neurochem 96, 1005-1015.
Santos M. S., Pereira E. M. and Carvaho A. P. (1999) Stimulation of immunoreactive insulin release by glucose in rat brain synaptosomes. Neurochem Res 24, 33-36.
Schechter R. and Abboud M. (2001) Neuronal synthesized insulin roles on neural differentiation within fetal rat neuron cell cultures. Brain Res Dev Brain Res 127, 41-49.
Schechter R., Beju D., Gaffney T., Schaefer F. and Whetsell L. (1996) Preproinsulin I and II mRNAs and insulin electron microscopic immunoreaction are present within the rat fetal nervous system. Brain Res 736, 16-27.
Schechter R., Whitmire J., Holtzclaw L., George M., Harlow R. and Devaskar S. U. (1992) Developmental regulation of insulin in the mammalian central nervous system. Brain Res 582, 27-37.
Schneppenheim R., Budde U., Dahlmann N. and Rautenberg P. (1991) Luminography--a new, highly sensitive visualization method for electrophoresis. Electrophoresis 12, 367-372.
Schubert M., Gautam D., Surjo D., Ueki K., Baudler S., Schubert D., Kondo T., Alber J., Galldiks N., Kustermann E., Arndt S., Jacobs A. H., Krone W., Kahn C. R. and Bruning J. C. (2004) Role for neuronal insulin resistance in neurodegenerative diseases. Proc Natl Acad Sci U S A 101, 3100-3105.
Schwartz M. W., Figlewicz D. P., Baskin D. G., Woods S. C. and Porte D., Jr. (1992) Insulin in the brain: a hormonal regulator of energy balance. Endocr Rev 13, 387-414.
Shoham S., Bejar C., Kovalev E. and Weinstock M. (2003) Intracerebroventricular injection of streptozotocin causes neurotoxicity to myelin that contributes to spatial memory deficits in rats. Exp Neurol 184, 1043-1052.
Stecher J., Muller W. E. and Hoyer S. (1997) Learning abilities depend on NMDA-receptor density in hippocampus in adult rats. J Neural Transm 104, 281-289.
Steen E., Terry B. M., Rivera E. J., Cannon J. L., Neely T. R., Tavares R., Xu X. J., Wands J. R. and de la Monte S. M. (2005) Impaired insulin and insulin-like growth factor expression and signaling mechanisms in Alzheimer's disease--is this type 3 diabetes? J Alzheimers Dis 7, 63-80.
Svaren J., Ehrig T., Abdulkadir S. A., Ehrengruber M. U., Watson M. A. and Milbrandt J. (2000) EGR1 target genes in prostate carcinoma cells identified by microarray analysis. J Biol Chem 275, 38524-38531.
Szkudelski T. (2001) The mechanism of alloxan and streptozotocin action in B cells of the rat pancreas. Physiol Res 50, 537-546.
Todd S., Yoshida M. C., Fang X. E., McDonald L., Jacobs J., Heinrich G., Bell G. I., Naylor S. L. and Sakaguchi A. Y. (1985) Genes for insulin I and II, parathyroid hormone, and calcitonin are on rat chromosome 1. Biochemical and Biophysical Research Communications 131, 1175-1180.
Ugozzoli L. A., Chinn D. and Hamby K. (2002) Fluorescent multicolor multiplex homogeneous assay for the simultaneous analysis of the two most common hemochromatosis mutations. Anal Biochem 307, 47-53.
Unger J., McNeill T. H., Moxley R. T., 3rd, White M., Moss A. and Livingston J. N. (1989) Distribution of insulin receptor-like immunoreactivity in the rat forebrain. Neuroscience 31, 143-157.
van Houten M., Posner B. I., Kopriwa B. M. and Brawer J. R. (1979) Insulin-binding sites in the rat brain: in vivo localization to the circumventricular organs by quantitative radioautography. Endocrinology 105, 666-673.
van Houten M., Posner B. I., Kopriwa B. M. and Brawer J. R. (1980) Insulin binding sites localized to nerve terminals in rat median eminence and arcuate nucleus. Science 207, 1081-1083.
Vandesompele J., De Preter K., Pattyn F., Poppe B., Van Roy N., De Paepe A. and Speleman F. (2002) Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 3, RESEARCH0034.
Wang Z., Dohle C., Friemann J., Green B. S. and Gleichmann H. (1993) Prevention of high- and low-dose STZ-induced diabetes with D-glucose and 5-thio-D-glucose. Diabetes 42, 420-428.
Weinstock M. and Shoham S. (2004) Rat models of dementia based on reductions in regional glucose metabolism, cerebral blood flow and cytochrome oxidase activity. J Neural Transm 111, 347-366.
Yamamoto H., Uchigata Y. and Okamoto H. (1981) Streptozotocin and alloxan induce DNA strand breaks and poly(ADP-ribose) synthetase in pancreatic islets. 294, 284-286.
Zhao W., Chen H., Xu H., Moore E., Meiri N., Quon M. J. and Alkon D. L. (1999) Brain insulin receptors and spatial memory. Correlated changes in gene expression, tyrosine phosphorylation, and signaling molecules in the hippocampus of water maze trained rats. J Biol Chem 274, 34893-34902.
Zhao W. Q., Chen H., Quon M. J. and Alkon D. L. (2004) Insulin and the insulin receptor in experimental models of learning and memory. Eur J Pharmacol 490, 71-81.
Figure Captions:
Figure 1: Normalized gene expression of IR, insulin-1 & -2 mRNA profiles and the ratio between insulin-1 to -2 in STZ treated rats in cortex, hippocampus and hypothalamus compared to controls. One-way ANOVA with Post-Hoc Test of Scheffee; a, p<0.005 vs. control, b, p 1 2 M N k п}u}nfn}}YI h/= CJ aJ mH nH sH tH h/= CJ H*aJ mH sH h : hX^ H* h : hX^ j *h/= H*h : h/= H* h : h/= hv h/= 5B*mH ph sH hv h : 5B*mH ph sH hv h 5B*mH ph sH hv hQzW 5B*mH ph sH hv hi 5B*mH ph sH hv hi 5B*mH ph sH h/= CJ \aJ mH sH P
? k
3
I
$d a$gdZ
$d a$gdC
$d a$gdS
$d a$gd/= d gd8 d gd/= d gd)
$d a$gd/= : ?
@
F
G
O
P
Q
|pcTB "h h/= 5CJ \aJ mH sH h? h/= mH nHsH tH h/= H*mH nHsH tHhQ h/= 5mH sH h/= mH sH hQ h/= mH sH hQ h/= 0J mH sH hQ h/= 0J 5mH sH h/= 0J 5mH sH h/= 0J 5mH sH h/= 0J 5H*mH sH hOw4 h/= mH sH h/= CJ aJ mH nH sH tH h8 CJ aJ mH sH h/= CJ aJ mH sH
; N V u w z { ͇q^K %h%& h%& B*CJ aJ mH ph sH %h%& h/= B*CJ aJ mH ph sH +h%& h/= 5B*CJ \aJ mH ph sH hS h/= 5CJ aJ mH sH hS huz CJ aJ mH sH hS h-$ CJ aJ mH sH h-$ CJ aJ mH sH huz CJ aJ mH sH h<% CJ aJ mH sH hS CJ aJ mH sH h/= CJ aJ mH sH h/= 5CJ \aJ mH sH % & ðtdTE55 j h/= CJ UaJ mH sH hr! h/= CJ aJ mH sH h: h/= 5CJ aJ mH sH h: hB[ 5CJ aJ mH sH h: hB[ CJ aJ mH sH "h: h/= 5CJ \aJ mH sH h/= 5CJ \aJ mH sH h/= CJ aJ mH sH %h\ h\ B*CJ aJ mH ph sH %h\ h>$ B*CJ aJ mH ph sH %h\ h/= B*CJ aJ mH ph sH +h\ h/= 5B*CJ \aJ mH ph sH & = > ? @ k
2
3
H
I
P
Q
¶zkXE %h
s h/= B*CJ aJ mH ph sH %h\ h/= B*CJ aJ mH ph sH h h/= CJ aJ mH sH h70 h/= CJ aJ mH sH h{f{ h/= CJ aJ h70 h/= CJ aJ h/= CJ aJ h{f{ h/= CJ aJ mH sH h/= CJ aJ mH sH j *h/= CJ aJ mH sH hZ h/= CJ aJ mH sH j h/= CJ UaJ mH sH hd CJ aJ mH nH sH u Q
R
3 ; A [ պ萁uiVCVCV0V %hq h?x B*CJ aJ mH ph sH %hq h>$ B*CJ aJ mH ph sH %hq hPG B*CJ aJ mH ph sH h h/= 5mH sH h. h/= 5mH sH hk6 h/= CJ aJ mH sH %h\ h/= B*CJ aJ mH ph sH ,h
s h/= 0J >* B*CJ aJ mH ph sH 4j h
s h/= B*CJ UaJ mH ph sH %h
s h/= B*CJ aJ mH ph sH .j h
s h/= B*CJ UaJ mH ph sH I
"= h U `) ^T Y ] ] ] ] $
+ d a$gd4
$d a$gdyM
$d a$gd4
$d a$gd
$d a$gd2{
$d a$gd[_
$d a$gdeqH
$d a$gd d gd4
$d a$gd
^3 d gdPG d gd/= 0 A f g
$ % " % . ? @ Q _ - U ܶzgggTgTgTgT %h%& h;6 B*CJ aJ mH ph sH %h%& h B*CJ aJ mH ph sH %h%& hq B*CJ aJ mH ph sH %h%& hK B*CJ aJ mH ph sH + j bh%& hPG B*CJ aJ mH ph sH %h%& hPG B*CJ aJ mH ph sH %hq hPG B*CJ aJ mH ph sH %hq hPG B*CJ aJ mH ph sH h
^3 B*CJ aJ mH ph sH 4 X Y B C O P _ ` a m 9 : ; Ƚtit^tiVJ j hV) UmH sH hV) mH sH hf h70 mH sH hf h/= mH sH j hf h/= UmH sH htF mH sH h70 mH sH j h/= UmH sH hP5 h/= mH sH hP5 h8 mH sH h/= mH sH h
h/= mH sH hz h/= 5mH sH h/= CJ aJ mH sH hPG CJ aJ mH sH %h%& hPG B*CJ aJ mH ph sH ; D/ E/ / / >0 [0 0 0 0 0 0 1 1 7 7 7 7 7 7 =
= = = "= A= R= V= t= x= ~= = = > > G G G G G G CS DS pS qS S S hY iY ~Y Y Y Y Y ɾ䦞䦞䖎䦞䦞䦞 hoS mH sH h x mH sH h70 mH sH j h/= UmH sH h h 5mH sH h hB[ mH sH h~{ hB[ mH sH hB[ mH sH hL mH sH h/= mH sH j hV) UmH sH hV) mH sH 5Y Y Z
Z Z Z Z Z Z Z ,_ -_ @_ A_ _ _ ?e @e Re Se e e Wj Xj nj oj j j j j Rp Sp gp hp jp q
q q q q !q "q 홑vk hag hXG mH sH hag hag mH sH h Y mH sH hc mH sH hag mH sH hXG mH sH h mH sH h=- h70 mH sH h=- h/= mH sH j h=- h/= UmH sH h70 mH sH j h/= UmH sH j bh/= mH sH h/= mH sH j ah/= mH sH )"q #q Jq Kq q q q q "v #v Gv Hv v v z z z z N{ O{ e f T U i j k f h ҋ ~s heqH h/= mH sH heqH mH sH hro mH sH hro hro B*mH ph sH hro h B*mH ph sH hro h^} B*mH ph sH h9C mH sH h70 mH sH j h/= UmH sH j bh/= mH sH j ah/= mH sH h/= mH sH hag h/= mH sH (ҋ Ӌ ь Ԍ
K L X Y ʏ ˏ ļĴĝyqyyqyqe]e h/= mH sH j h/= UmH sH h\^ mH sH h6Zq mH sH h70 mH sH j h/= UmH sH h~G mH sH h/= mH sH h%- hb B*mH ph sH h%- mH sH h m mH sH h0 mH sH hI/t h-4 mH sH hI/t hI/t mH sH h-4 mH sH heqH h-4 mH sH heqH heqH mH sH ! % & ( t x { ڛ ۛ # $ & . x y ± ı ű Ʊ ϱ ۱ & ) v ºβªΞqbS h5 h
B*mH ph sH h5 h[_ B*mH ph sH h
h[_ B*mH ph sH h
h= B*mH ph sH h
h/= B*mH ph sH h
B*mH ph sH h70 mH sH h mH sH hNJ mH sH j h/= UmH sH h/= mH sH hu h/= mH sH hx h/= mH sH j h/= UmH sH h70 mH sH v w + , Q R T U p x ȴ
= > ? I K ˵ ̵ ͵ յ ݵ νyncnXnXcnc h|
hr mH sH h|
h mH sH h|
h mH sH h|
hva mH sH h} mH sH h?( mH sH h5_ mH sH h|
h/= mH sH h|
h0 mH sH h|
h62 mH sH h
h[_ 5B*mH ph sH h
h[_ B*mH ph sH h5 h
B*mH ph sH &j h5 h
B*UmH ph sH ~ Ͷ ζ ϶ Զ " ) N n x ÷ ķ ۻ ܻ T Ʒب؊{lll{`X`P`Hh/= mH sH h70 mH sH hr mH sH j hr UmH sH h7 hC~ B*mH ph sH h7 h/= B*mH ph sH h7 hr B*mH ph sH h7 h
B*mH ph sH h7 hJ B*mH ph sH h7 h) F) L) ]) ^) _) `) n) ~) ) ) ) * źxxphp`pT j htM UmH sH hV) mH sH h;8 mH sH h^gK mH sH hX hK` mH sH hX hE mH sH hX h@ mH sH hX h62 mH sH hX h;8 mH sH h2{ h;8 mH sH h2{ hE mH sH h2{ h2{ mH sH h2{ hOR mH sH j h2{ hOR UmH sH h#I hOR mH sH h#I h mH sH * #. $. 8. 9. w. x. a3 b3 {3 |3 3 3 3 S> T> > > > > > > G G !H "H |H }H 7N 8N PN QN RN SN @O AO aO bO +T ,T [T \T Ȭwlwlw h he! mH sH j h he! UmH sH he! h6z mH sH he! hcT mH sH hcT mH sH h (l mH sH j h (l UmH sH h
mH sH hX mH sH hv mH sH j hv UmH sH hf9 mH sH hS-| mH sH j htM UmH sH htM mH sH )\T ]T ^T T T T gU hU iU jU U U U Y Y 3Y 4Y Y Y Y Y >[ @[ G[ K[ v[ [ [ [ [ [ ױץױוwhwYwYhY hT} hc.( B*mH ph sH hT} hS B*mH ph sH hT} h} B*mH ph sH hT} hyM B*mH ph sH hcT mH sH h70 mH sH j h/= UmH sH h;8 mH sH j bh/= mH sH j ah/= mH sH h\q mH sH h/= mH sH h6z mH sH h h^gK 5mH sH h h 5mH sH [ [ [ [ [ [ J\ W\ X\ [\ }\ ] )] =] E] F] i] z] ] ] ] ] ] ] ] ^ ^ Y^ s^ ^ ^ ^ ^ һ}od\d\d\d\S h/= H*mH sH h/= mH sH hvw h/= mH sH hvw h/= 56mH sH h+ h/= 5mH sH hd h mH sH hT} B*mH ph sH hyM B*mH ph sH h D hyM B*mH ph sH hyM mH sH hT} hS B*mH ph sH hT} hyM B*mH ph sH hT} hc.( B*mH ph sH hT} hT} B*mH ph sH ^ ^ ^ ^ ^ ^ I_ L_ M_ ` "a $a a a hc lc rc ~c c c ze {e e e e f 'f bf lf mf nf ѻyqeZ h7\ h/= mH sH hvw h/= 6mH sH h
^ mH sH h/#} mH sH hvw h/= mH sH hG h/= 56mH sH hH hH mH sH hH h
^ mH sH hH hSo mH sH hH h/= mH sH hG h/= mH sH h/= mH sH h h/= mH sH h+ h/= mH sH h/= H*mH sH h/= mH sH ] {e e nf ~f 4o p q bq q dr 2s u w g Y _ : R d gdPX
$d a$gd4 $
+ d a$gdz! $
+ d a$gd4 nf ~f f f f f f f f g g g g g m m m m m Sm _m n n nn vn xn |n n .o 0o 2o 4o Do Ro \o o o ti^^ס hvw h mH sH hvw h/= mH sH hD) h/= 56mH sH $o o o o #p &p *p p p p p p p dr nr r r 2s t >t nt u u %v :v Hv Vv lv }v v v v Rw [w w w Ux Yx kx lx | | | | } } } } F} G} ̬} h
+ mH sH hsU h/= mH sH h70 mH sH j h/= UmH sH h^Q> mH sH h/= mH sH h> h/= EH mH sH h> h/= mH sH hvw h/= mH sH h
^ mH sH hm h
^ mH sH hm h ? \ i j { - 1 ? O X Y ˿y hu h/= 5\aJ mH sH h$6 h/= ^J mH sH h h/= ^J mH sH hPX mH sH hu h/= mH sH h/= 6mH sH hu h/= 6mH sH h. h/= 56mH sH hvw h/= mH sH h70 mH sH j h/= UmH sH h/= mH sH -Y _ k 2 d g 5 9 dž Ȇ
T U V ~ O 䝱ڀڀvk h h/= mH sH h70 ^J mH sH j h/= U^J mH sH h$6 h/= 0J ^J mH sH 'j h$6 h/= U^J mH sH !j h$6 h/= U^J mH sH h$6 h/= H*^J mH sH hTr ^J mH sH h/= ^J mH sH h$6 h/= ^J mH sH h. h/= 6^J mH sH ' % ) K L g К G b s w қ ӛ ; < [ _ $ - j bh/= 56mH sH j bh
= h/= 56mH sH ho h/= 56mH sH h h/= H*mH sH h h/= mH sH h h/= >*mH sH h70 mH sH j h/= UmH sH h h/= mH sH h/= mH sH 1- 4 : R J ̟ ͟ b c d $ % 4 5 M | d l ʥ ܥ / 0 9 ȷȷȬȉȉȕȕsȷȷh h] h/= mH sH hEQ h/= 6]mH sH h70 mH sH j h/= UmH sH h(z h/= mH sH hJ h/= 6mH sH hD&n h/= mH sH h/= H*mH sH h
^3 mH sH h/= mH sH hOz= h/= mH sH h+ h/= 6mH sH ho h/= 56mH sH h/= 56mH sH # 0 W V \ c
$d a$gdt
$d a$gd $
+ d a$gdI $d 7$ 8$ H$ a$gd4 $
+ d a$gd4
$d a$gd4 9 G V W ӧ V # $ & D F ޱ Z [ v w x y ˽ܵ{{oc[c[c{ hI mH sH j hI UmH sH ht h[7 6mH sH ht h[7 H*mH sH ht h[7 mH sH ht h[7 >*mH sH ht h[7 56mH sH h/= H*mH sH h/= mH sH h/= OJ QJ ^J mH sH h0q h/= OJ QJ ^J mH sH h0q h/= mH sH h/= 56mH sH h
= h/= 56mH sH Q R < ? A B ^ h V d \ c |p|p|p|peW h h/= 56mH sH ht h mH sH h/= B*mH ph)%& sH h 7 h/= B*mH ph)%& sH #h 7 h/= 56B*mH ph)%& sH ht hF 6mH sH hP5 h& mH sH hP5 hF mH sH h
^3 mH sH ht hF H*mH sH h mH sH j h UmH sH ht hF 56mH sH ht hF mH sH !c [ 4 7 H ʿsdsUsdsJJJ j bh/= mH sH hC hS B*mH ph sH hC hn; B*mH ph sH hC h/= B*mH ph sH ht h/= mH sH ht h 6mH sH ht h >*mH sH ht haT1 >*mH sH ht h 56mH sH hJlg h/= mH sH h 5mH sH h; h/= 5mH sH hN Y 5mH sH h/= mH sH hh5 mH sH h/= mH sH - 1 h $ zrg_rWH hw h/= B*mH ph sH h mH sH h- mH sH h- h/= mH sH hZ mH sH j bh/= mH sH h > hn; B*mH ph sH h > hH B*mH ph sH h > hM; B*mH ph sH h > h/= B*mH ph sH hU# mH sH haT1 mH sH hr h/= mH sH h mH sH h h >*mH sH h/= mH sH hP mH sH u % B [ \ g x 1G b
$d a$gd
$d a$gd
$d a$gdJ]
$d a$gdsz
$d a$gd&
$d a$gd4
$d a$gd
$d a$gdr # ] ` a e i ' 4 t u S l ³ᤕxj_T_ h% h_>$ mH sH h% hci mH sH h% hu1 56mH sH h% h 56mH sH hw h#W B*mH ph sH hw hr- B*mH ph sH hw hHa B*mH ph sH hw hW B*mH ph sH hw hw B*mH ph sH haT1 mH sH h/= mH sH hw h/= B*mH ph sH hw hH B*mH ph sH l m p q x y " # % A B F b u y ߾ԳԝԾԳvɳgXI hN hN B*mH ph sH hN h#W B*mH ph sH hN hq B*mH ph sH h% hyN mH sH h% h 56mH sH h% hci 56mH sH h% hI mH sH h% hI mH sH h% hq mH sH h% hci mH sH h% h mH sH h% hT mH sH h% h_>$ mH sH h% hd; mH sH h% hJ F mH sH " X q r s | ) K L P h l y ~ W ` c ÷άuju hR hMU mH sH hR hI mH sH hR hT mH sH hR hiAt mH sH hR hci mH sH hR h mH sH hR hq mH sH h B*mH ph sH h% h mH sH h#W mH sH h% hq mH sH hN hq B*mH ph sH hN h#W B*mH ph sH ) " - 1 5 @ G Y e j q } + Y Z [ \ ȹ}}nnnn}cX hci h mH sH hR h|q mH sH hN h5
B*mH ph sH hN hY B*mH ph sH hN hyN B*mH ph sH hN hg B*mH ph sH hN hAG B*mH ph sH hN hI B*mH ph sH hN h B*mH ph sH hR h mH sH hR hN mH sH hN mH sH hR hiAt mH sH \ g x 1 9 @ A J οݰwwowgXI hN & hN & B*mH ph sH hN & h* B*mH ph sH h* mH sH h70 mH sH j h/= UmH sH hN & h~ B*mH ph sH h *A h *A B*mH ph sH h *A h%l B*mH ph sH h *A h/= B*mH ph sH hN & hI B*mH ph sH hN & h/= B*mH ph sH h/= mH sH h} r h/= 56mH sH hjk h/= 5mH sH J P Q W n 9 : L M = ? \ ] R S e f g ᴬyqf[OGOGO[ h mH sH j h UmH sH h\ h5 mH sH h\ h/= mH sH h5 mH sH h70 mH sH j h/= UmH sH h= mH sH h/= mH sH h9 h/= B*mH ph3f sH hN & mH sH hN & hN & B*mH ph sH hN & h/= B*mH ph sH hN & h* B*mH ph sH hN & hY
B*mH ph sH hN & h9 B*mH ph sH g h 4 5 G H
< e f x S T { | } ~ Ƚ{sb h< hu 56\]mH sH hJ] mH sH hO# hO# mH sH hO# h70 mH sH hO# h/= mH sH h. h/= mH sH hJ] h/= mH sH hJ] hQ9 mH sH hJ] hJ] mH sH hJ] mH sH h h/= 6mH sH h70 mH sH j h/= UmH sH h/= mH sH h5 mH sH " " " " " " " C# D# ' ' .' /' 1' ' ' ( ( 5 5 6 6 6 +6 66 6 6 6 : : *: +: H: I: ܜxldldldl h^D mH sH j h^D UmH sH h8
mH sH hjL7 mH sH hb mH sH j hb UmH sH h& mH sH hY mH sH j hY UmH sH hQ9 mH sH hN mH sH h70 mH sH j h/= UmH sH h/= mH sH hKp h/= mH sH h< h/= 56\]mH sH %I: $B %B SB TB fB gB G G -G .G 0G 1G G {H |H H H yO zO O O O O O O P P P MV NV cV dV fV V V _ xld h_- mH sH j h_- UmH sH hH mH sH hg mH sH j hg UmH sH h$ mH sH hi mH sH h f mH sH j h f UmH sH h mH sH hTf mH sH h/= mH sH hZW
mH sH j hZW
UmH sH h^D mH sH j h^D UmH sH h~nY mH sH $_ te ue e e e 'f (f df ef k k
l l kl ll y y y y y y р Ҁ ; < E K f g 鮦鮞{p hg'l h
7 mH sH hg'l h+ mH sH h+ mH sH h mH sH hm+ mH sH hZW
mH sH h
7 mH sH h! mH sH hd{ mH sH hEu mH sH h_- mH sH huI mH sH hH mH sH h_- hH mH sH j h_- UmH sH h_- h_- mH sH (g x Ʉ ʄ ΄ τ " + 0 1 D d Ð Đ ې < G M R W ŶŪśśŌxixixŶŌZZ h| h B*mH ph sH h| h7-
B*mH ph sH &j h| h7-
B*UmH ph sH h| h| B*mH ph sH h| hQb6 B*mH ph sH hP5 B*mH ph sH h| hyN B*mH ph sH h| h+ B*mH ph sH hg'l h+ mH sH hg'l hQb6 mH sH hg'l h
7 mH sH hg'l h mH sH "W Y ˑ ڑ ݑ ! @ R U ` b l m y z | ô|tldld\lMldl h| hu^R B*mH ph sH hu^R mH sH h mH sH h. mH sH h_ mH sH h7-
h7-
mH sH h| h7-
B*mH ph sH h| h_ B*mH ph sH h| hyN B*mH ph sH h| h| B*mH ph sH h| mH sH h7-
h_ mH sH h7-
h. mH sH h| h B*mH ph sH h| h. B*mH ph sH ' Փ ݓ O Q R s z Ԕ ܔ
) / = @ A ŶŶzzkzkzk\K j h-I B*UmH ph sH h8 h| B*mH ph sH h^qO h| B*mH ph sH h^qO hWF B*mH ph sH h^qO h%l B*mH ph sH h^qO h B*mH ph sH h^qO h_ B*mH ph sH h^qO h}X B*mH ph sH h^qO h|q B*mH ph sH h7-
h|q mH sH h7-
h. mH sH h7-
h~b mH sH h7-
h}X mH sH A Λ ϛ ! / 9 A D c f g k l { ~ yj[LAL hP5 h_ mH sH hP5 h_ B*mH ph sH hP5 h_ B*mH ph sH hEh< h_ B*mH ph sH h7-
h~b mH sH h7-
hk{ mH sH h2 mH sH hEh< h2 B*mH ph sH hEh< h_ B*mH ph sH h7-
h_ mH sH h7-
hm+ mH sH h| mH sH h8 h%l B*mH ph sH j h-I B*UmH ph sH h-I B*mH ph sH ~ h a b u v Ц Ѧ ` a g h ôôwwwl`U h h} mH sH h} B*mH ph sH h7-
h} mH sH j h7-
hs UmH sH h3h} mH sH j h3h} UmH sH h7-
hs mH sH hEh< h B*mH ph sH hEh< hEh< B*mH ph sH hEh< h%l B*mH ph sH hP5 hEh< B*mH ph sH hP5 h%l B*mH ph sH hP5 hEh< B*mH ph sH ߮ X ͯ ү ! , - . ʰ ˰ O P ֺ b Ͼ Ǹǰxxxpxd\hl\ mH sH j hl\ UmH sH h mH sH h~nY mH sH j h~nY UmH sH h \ mH sH hT2S mH sH j hT2S UmH sH hm+ mH sH h mH sH h h
. B*mH ph sH h h B*mH ph sH h h@K B*mH ph sH h"kC mH sH h@K mH sH h h mH sH $Ͼ о c d u v w O P e f h n U V * + > ? ̵ĵġ}u}u h# mH sH h- mH sH hDxf mH sH j hDxf UmH sH h< mH sH h mH sH h{" B*mH ph sH h"~ h"~ B*mH ph sH h"~ mH sH j h"~ UmH sH h"~ h"~ mH sH h@K mH sH hl\ mH sH j hl\ UmH sH + h F ( Z h $hd ^h`a$gd_ gd/=
$d a$gd/= $a$gdB[
$d a$gd4
$d a$gd
$d a$gd"~ ? * o D G N O n o p q D E F ʿݿ嫌}n_n h h *A B*mH ph sH h h&F B*mH ph sH h hQzW B*mH ph sH h(a mH sH j bh- mH sH hoJ B*mH ph sH hoJ mH sH j hoJ UmH sH h3h} hoJ mH sH h3h} h~ mH sH h~ mH sH hL: mH sH h- mH sH j bh5 mH sH h5 mH sH ! # $ i W X wlwdXPXHXw h-I mH sH hNJ mH sH j hNJ UmH sH h+R mH sH j bhDxf mH sH hDxf mH sH h&F hE B*mH ph sH hE mH sH hBu- B*mH ph sH # j bh h&F B*mH ph sH h h&F B*mH ph sH h h B*mH ph sH h hh B*mH ph sH h h
. B*mH ph sH h h;U B*mH ph sH < F J ] s v
! " X Y r s t u 0 1 ٻwwhYJ h! hk B*mH ph sH h! hf B*mH ph sH h! h&F B*mH ph sH h! hNJ B*mH ph sH &j h! hNJ B*UmH ph sH h! h4b B*mH ph sH # j bh! h+R B*mH ph sH h! h+R B*mH ph sH h! h} B*mH ph sH h! hDxf B*mH ph sH hBu- mH sH hDxf mH sH h} mH sH 1 2 G S T X x y | P j o s ôҥxpdYQYQYQI h\r mH sH h/= mH sH h:B h/= mH sH h:B h/= 5mH sH h} mH sH h! hE B*mH ph sH h! hJ B*mH ph sH h! h4b B*mH ph sH h! h *A B*mH ph sH h! h B*mH ph sH h! h^sW B*mH ph sH h! h! B*mH ph sH h! hf B*mH ph sH h! hh B*mH ph sH 6 e h q e u v z = Ӟsgsgsgsgsgsg h_ h_ 5mH sH h_ h_ 6mH sH h_ mH sH j h_ UmH sH hL" h/= mH sH h:B h/= 5mH sH h3h} h/= mH sH h3h} huz mH sH h3h} h/= mH sH hf mH sH h/= mH sH h\r h/= mH sH h\r h\r B*mH ph sH h:B h\r mH sH (= M N S J W X ] M Z [ _ J b c g ` r s w
& ' , 4
C
D
I
} $ h_ h_ 5mH sH h_ mH sH h_ h_ 6mH sH X h t
7 R
- ' ! R $hd ^h`a$gd_ x 4 C D I D y a l m r ! & 2 3 8 x h v w z + ; < A ! ! ! ! h_ h_ 5mH sH h_ mH sH h_ h_ 6mH sH X 3 A J ! ! " S# # $ :% % & ' ' ( p) >* * + $hd ^h`a$gd_ ! ! " " " " ?# H# I# N# # # # # $ $ $ $ % '% (% -% % % % % & & & & & & & & ' ' ' ' ( ( ( ( J) b) c) g) * /* 0* 5* * * * * d+ q+ r+ w+ l, w, x, |, - - - "- - - - - . . . . R/ [/ \/ a/ / 0 0
0 1 ,1 -1 21 1 1 1 h_ h_ 6mH sH h_ mH sH h_ h_ 5mH sH X+ , )- - . h/ 0 =1 1 2 ^3 }4 K5 5 6 7 p8 M9 : : ; u< = => > > $hd ^h`a$gd_ 1 1 2 2 2 2 @3 O3 P3 U3 b4 r4 s4 v4 -5 85 95 >5 5 5 5 5 6 6 6 6 7 7 7 7 V8 b8 c8 g8 19 >9 ?9 D9 9 9 9 9 : : : : ; ; ; ; W< f< g< l< = = > *> +> 0> > > > > > > > > > h h/= 5mH sH hvf mH sH hc> h_ mH sH j h_ UmH sH h_ h_ 6mH sH h_ mH sH h_ h_ 5mH sH D> > N Y # 1 F L l ~
p# d $If gd/= l { $ed ^e`a$gd]t $
ed ^e`a$gdeS $hd ^h`a$gd ,/ $hd ^h`a$gduR $hd ^h`a$gdP
> > > > 4? mH sH h3h} heS mH sH h3h} heS mH sH h3h} heS 5mH sH h3h} h/= mH sH h ,/ mH sH hu: h/= mH sH j bh/= mH sH h/= 5mH sH UhuR mH sH h/= mH sH h(n; h/= mH sH h h/= 5mH sH h/= mH sH '<0.05 vs. control.
Figure 2: IR( concentration, IR pTyr1158, IR pTyr1162/1163, protein tyrosine kinase activity, and ratio with pTyr1158 and with pTyr1162/1163 in STZ treated rats in cortex, hippocampus and hypothalamus compared to control. One-way ANOVA with Post-Hoc Test of Scheffee; a, p<0.005 vs. control, b, p<0.05 vs. control.
Figure 3: Western blot analysis of total tau visualized by K9JA antibody recognizing C-terminal part of tau protein (A) and phospho (p) tau visualized by PHF-1 anti-tau antibody recognizing tau phoshorylated at serine S-396 and S-404 (B) protein in the hippocampus of rats intracerebroventricularly (icv) treated with streptozotocin (1 mg/kg) 3 months after drug treatment, and respective statistics (C). CTRL, control group (lanes 1-5); STZ, streptozotocin icv-treated group (lanes 6-11). *p<0.05 by Mann Whitney U test.
Figure 4: Memory function in Morris Water Maze Swimming Test of rats intracerebroventricularly (icv) treated with streptozotocin and glucose transporter GLUT2 blockers, 5-thio-D-glucose, and 3-0-methyl glucose. Deficits were measured as the time spent in search for the removed platform after entering the quadrant where the platform had been placed in training trials. The better the memory had been preserved, the longer the rats were searching for the platform, and vice versa. Values are expressed as a mean with a standard error and standard deviation range. CTRL, control group; STZ1x, streptozotocin single injection (1 mg/kg, icv) ; STZ3x, streptozotocin triple injection ( 3 x 1 m g / k g , i c v ) ; 3 0 M G , 3 - 0 - m e t h y l g l u c o s e t r i p l e i n j e c t i o n ( 3 x 1 m g / k g , i c v ) ; T G , 5 - t h i o - D - g l u c o s e t r i p l e i n j e c t i o n ( 3 x 3 7 5 g / k g , i c v ) . * p < 0 . 0 5 v s . c o n t r o l b y K r u s k a l - W a l l i s A N O V A m e d i a n t e s t f o l l o w e d b y M a n n W h i t n e y U t e s t . T a b l e 1 : Q u a n t i t a t i v e P C R c o nditions and kits
GeneGene SymbolAccession No.Firm Kit descriptionProbePrimer sequence (Forwar+Revese)Product side (bp)Annealing Temperatur (0C)Insulin 1Ins1NM_019129Qiagen QuantiTect Primer Assay Cat. No. QT00373303---n.a.11455Insulin 2Ins2NM_019130Qiagen QuantiTect Primer Assay Cat. No. QT00177380---n.a.11655Insulin receptorIRNM_017071Qiagen QuantiTect Primer Assay Cat. No. QT00198968---n.a.9255Ribosomal 18SRnr1M11188Qiagen QuantiTect Primer Assay Cat. No. QT00199374---n.a.10355glyceraldehyde-3-phosphate dehydrogenaseGapdNM_017008No kit (TaqMan Probe)atgcccccatgtttgtgatgggtgtTcaccaccatggagaaggc
gctaagcagttggtggtgca17862Actin betaActxNM_031144No kit (TaqMan probe)tgtccctgtatgcctctggtcgtaccacAgccatgtacgtagccatcca
tctccggagtccatcacaatg8165Not available, n.a.
Table 2: Nor m a l i z e d g e n e e x p r e s s i o n p r o f i l e s ( A ) a n d P T K a c t i v i t y a n d I R - s u b u n i t p r o t e i n u n d e r c o n t r o l c o n d i t i o n s i n d i f f e r e n t b r a i n a r e a s .
A ) g e n e C o r t e x ( M e a n S E M , n ) H i p p o c a m p u s ( M e a n S E M , n ) H y p o t h a l a m u s ( M e a n S E M , n ) I R ( F = 1 . 5 5 ) 0 . 3 2 1 0 . 0 4 8 ( 3 ) 0 . 3 7 0 0 . 0 6 7 ( 4 )0.1660.099 (6)Insulin-1 (F=5.7)0.9800.529 (4)2.6180.784 (4)0.2460.164 a (5)Insulin-2 (F=2.5)0.2640.079 (3)0.4570.201 (4)0.0840.050 (5)Insulin-1/insulin-23.76.695.73.902.93.28B) ProteinIR( (ng/ng total protein)
F=4.95.1540.744 a (5)2.2680.764 (5)3.9970.386 (6)IR pTyr1158 (ng 6 Y c . 8 l\l\l\lMl\l\ hI h/= CJ aJ mH sH h/= CJ OJ QJ aJ mH sH $hI h/= CJ OJ QJ aJ mH sH h/= CJ OJ QJ aJ hI h/= CJ aJ hI h/= CJ H*OJ QJ aJ hI h/= CJ OJ QJ aJ h]t h/= mH sH hI h/= CJ aJ hI h/= 5CJ \aJ h/= h3h} heS 6mH sH h3h} heS 5mH sH h3h} heS mH sH 9
p# d $If gd/= l A kd4 $$If F ִ s=G uY x$ w
t 6 4 4
l a
p# d $If gd/= l A 9
p# d $If gd/= l ,A kd $$If F ִ s=G uY x$ w
t 6 4 4
l a B F K O R
p# d $If gd/= l ,A 7 ; A B E K N R S g p
: ; ? @ I $ & * + u&hI h/= 0J 6CJ OJ QJ ]aJ *hr h/= 6CJ OJ QJ ]aJ mH sH &hr h/= 0J 6CJ OJ QJ ]aJ hI h/= CJ aJ mH sH h/= CJ OJ QJ aJ mH sH h/= CJ OJ QJ aJ hI h/= CJ OJ QJ aJ $hI h/= CJ OJ QJ aJ mH sH .R S d g 9
p# d $If gd/= l @ kd $$If F ִ s=G uY x$ w
t 6 4 4
l a g q
p# d $If gd/= l @ 9
p# d $If gd/= l $@ kd $$If F ִ s=G uY x$ w
t 6 4 4
l a
p# d $If gd/= l $@ ; @ 9
p# d $If gd/= l A kd $$If F ִ s=G uY x$ w
t 6 4 4
l a @ J ` z
p# d $If gd/= l A 9
p# d $If gd/= l ,A kd{ $$If F ִ s=G uY x$ w
t 6 4 4
l a $ ' *
p# d $If gd/= l ,A * + ? @ 9 - 0d ^`0gd/=
p# d gd/= kdV $$If F ִ s=G uY x$ w
t 6 4 4
l a + ? @ I $ % Q R W X a e i j ططططummme h9= mHsH h/= mHsH j bh/= mH sH h h/= mHsH h9+ \mH sH h/= H*mH sH hYL \mH sH h/= mH sH h= \mH sH hHc h/= \mH sH hM h/= 5mH sH h/= \mH sH h/= 5mH sH h/= CJ aJ mH sH $hI h/= CJ OJ QJ aJ mH sH &@ @ t F y kd1 $$If F \
)7
t 6 4 4
l a $d $If a$gd/= l { d $If gd/= l { 0d ^`0gd/= % V @ d $If gd/= l nA y kd $$If F \
)7
t 6 4 4
l a $d $If a$gd/= l ,A d $If gd/= l ,A % 5 E W X j z l V = $d $If a$gd/= l @ d $If gd/= l @ y kd $$If F \
)7
t 6 4 4
l a $d $If a$gd/= l nA z l V = = $d $If a$gd/= l f@ d $If gd/= l f@ y kd~ $$If F \
)7
t 6 4 4
l a $d $If a$gd/= l @ l V V d $If gd/= l ,A y kd $$If F \
)7
t 6 4 4
l a $d $If a$gd/= l f@
* | | | $d $If a$gd/= l nA d $If gd/= l nA S kd\
$$If F 0
7 D*
t 6 4 4
l a
) * + 7 8 " , : < D F P d f p
ø϶뮣㸗돇| hb ho5 mHsH hm mHsH ho5 mHsH hHc h/= 5mHsHhb h2" mHsH h2" mHsH Uhb h/= mHsH hqE h/= 5mHsHh h/= mHsH h/= H*mH sH h/= mH sH h/= mHsH hqE h9= 5mHsH 0* + " F f o o V V V $d $If a$gd/= l @ d $If gd/= l @ y kd
$$If F \
)7
t 6 4 4
l a / n g I R )
( F = 7 . 9 ) 1 . 1 3 8 0 . 1 5 4 a ( 5 ) 1 . 9 3 2 0 . 1 4 6 ( 5 ) 1 . 4 9 9 0 . 1 1 0 ( 7 ) I R p T y r 1 1 6 2 / 1 1 6 3 ( n g / n g I R )
( F = 1 4 . 3 ) 1 . 1 5 0 0 . 1 0 1 b ( 5 ) 1 . 2 1 5 0 . 1 1 7 b ( 5 ) 1 . 7 5 8 0 . 0 4 9 ( 6 ) P r o t e i n T y r o s i n e k i n a s e a c t i v i t y ( n g / g t o t a l p r o t e i n / 3 0 m i n )
( F = 1 4 . 1 ) 3 . 0 0 9 0 . 5 0 8 a , b ( 5 ) 1 . 3 1 2 0 . 3 8 7 ( 5 ) 0 . 6 0 3 0 . 0 9 6 ( 7 ) P T K / I R p T y r 1 1 5 8 ( n g / n g p T y r 1 1 5 8 / 3 0 m i n ) ( x 1 0 3 )
( F = 3 4 . 7 ) 2 5 . 9 1 . 4 a , b ( 5 ) 1 6 . 1 2 . 9 b ( 5 ) 5 . 7 0 . 9 ( 7 ) P T K / I R p t y r 1 1 6 2 / 1 1 6 3 ( n g / n g p T y r 1 1 6 2 / 1 1 6 3 / 3 0 m i n ) ( x 1 0 3 )
( F = 2 3 . 0 7 ) 2 5 . 9 3 . 6 b ( 5 ) 2 5 . 5 3 . 6 b ( 5 ) 4 . 7 0 . 9 ( 7 ) O n e - w a y A N O V A w i t h P o s t - H o c S c h e f f e e - T e s t : a , p < 0 . 0 5 v s . h i p p o c a m p u s ; b , p < 0 . 0 5 v s . h y p o t h a l a m u s
J . N e u r o c h e m . J N C - E - 2 0 0 6 - 0 5 8 9 . R 1 G r n b l a t t e t a l .
P A G E
P A G E 1
<
o o V V V $d $If a$gd/= l f@ d $If gd/= l f@ y kd0 $$If F \
)7
t 6 4 4
l a
&
:
<
>
4 6 * D R l p r t th`X hL mHsH hL mH sH h# h/= 5mH sH h# h/= H*mH sH h|b h|b 5mH sH h|b mH sH h/= mH sH h/= H*mH sH h# h/= mH sH hqE h/= 5mH sH h/= H*mH sH hqE h)} 5mH sH h)} mH sH hHc h/= 5mHsHh/= mHsH hb h/= mHsH h/= mH sH <
>
4 o o V V V $d $If a$gd/= l ,A d $If gd/= l ,A y kd $$If F \
)7
t 6 4 4
l a 4 6 o o V V V $d $If a$gd/= l nA d $If gd/= l nA y kd $$If F \
)7
t 6 4 4
l a r o o V V V $d $If a$gd/= l @ d $If gd/= l @ y kd $$If F \
)7
t 6 4 4
l a
, . 0 2 4 8 : < Ž hd hd 0J mH nH u
h4 0J j h4 0J Uh-: hw h4 h_ mH sH h/ mH sH hW: h/= mH sH h# h/= 5mH sH h/= H*mH sH h/= mH sH hL hL mH sH 4 u m m k i ] [ i ] &`#$gd/= d gda 0d ^`0gd`| y kd
$$If F \
)7
t 6 4 4
l a
4 6 8 : < d gda 9 01h P :p/= . A!"#$n% < 01h 0 P :p/= A .!"n#$% D y K & e d n a . g r u e n b l a t t @ m a i l . u n i - w u e r z b u r g . d e y K Z m a i l t o : e d n a . g r u e n b l a t t @ m a i l . u n i - w u e r z b u r g . d e D y K ) h t t p : / / m e d g e n . u g e n t . b e / ~ j v d e s o m p / g e n o r m / y K R h t t p : / / m e d g e n . u g e n t . b e / ~ j v d e s o m p / g e n o r m / $$If !v h5 55
5.5555#v #v#v
#v.#v#v#v#v:V F
t 6 5 w555555 $$If !v h5 55
5.5555#v #v#v
#v.#v#v#v#v:V F
t 6 5 w555555 $$If !v h5 55
5.5555#v #v#v
#v.#v#v#v#v:V F
t 6 5 w555555 $$If !v h5 55
5.5555#v #v#v
#v.#v#v#v#v:V F
t 6 5 w555555 $$If !v h5 55
5.5555#v #v#v
#v.#v#v#v#v:V F
t 6 5 w555555 $$If !v h5 55
5.5555#v #v#v
#v.#v#v#v#v:V F
t 6 5 w555555 $$If !v h5 55
5.5555#v #v#v
#v.#v#v#v#v:V F
t 6 5 w555555m $$If !v h5 555#v #v:V F
t 6 5 5m $$If !v h5 555#v #v:V F
t 6 5 5m $$If !v h5 555#v #v:V F
t 6 5 5m $$If !v h5 555#v #v:V F
t 6 5 5m $$If !v h5 555#v #v:V F
t 6 5 5] $$If !v h5 5D*#v #vD*:V F
t 6 5 5D*s $$If !v h5 555#v #v:V F
t 6 ,5 5s $$If !v h5 555#v #v:V F
t 6 ,5 5s $$If !v h5 555#v #v:V F
t 6 ,5 5s $$If !v h5 555#v #v:V F
t 6 ,5 5s $$If !v h5 555#v #v:V F
t 6 ,5 5s $$If !v h5 555#v #v:V F
t 6 ,5 5 @ @ @ /= N o r m a l CJ _HaJ mHsHtH D A@ D D e f a u l t P a r a g r a p h F o n t R i@ R T a b l e N o r m a l 4
l 4 a ( k ( N o L i s t * W@ * /= S t r o n g 5\6 U@ 6 /= H y p e r l i n k >*B*ph 4 B@ 4 /= B o d y T e x t $a$ < P@ "< /= B o d y T e x t 2 d x J O 2J /= F o o t e r 1
p# OJ QJ aJ mH sH . X@ A. /= E m p h a s i s 6]4 @ R4 /= H e a d e r
p# . )@ a. /= P a g e N u m b e r 4 @ r4 /= F o o t e r
p# 1 g6 " ;" && . 8/ / / T0 0 m1 h6 @ 0 R ^~00 | *^~00 | +^~00 | D+^~00 | |+^~00 | @^~00 | ^~0 0 | `@ 0 R P ? k 3 I "5 h U `! ^L Q U U U U [ [ \ \ qd _e e 9f f ;g h h j yt t t kw qw L d / C j ̛ ( H 4 ? A _ | X k0 Tm Um ˗ ' ? . l 3 d X G " % ^ { Q q k : e w c I 9 M
> ~
H
; m Z + * K! C" " # `$ % $& && 8& V' ( * U. Z. f. t. . . . . . . . . . (/ ,/ 1/ 5/ 8/ 9/ C/ H/ R/ / / / / / / / / / / / / / / / 0
0 0 D0 H0 M0 Q0 T0 U0 ~0 0 0 0 0 0 0 0 0 0 0 0 1 1 ;1 Q1 g1 j1 m1 n1 1 1 2 2 /2 I2 d2 e2 q2 2 2 2 2 2 2 2 2 2 2 3 3 )3 *3 >3 G3 P3 Y3 Z3 e3 f3 g3 3 3 3 3 3 3 3 3 3 3 4
4 *4 34 E4 W4 g4 h4 4 4 4 4 4 4 5 5 -5 <5 H5 I5 5 5 5 5 5 5 6 6 6 L6 M6 V6 W6 X6 c6 d6 e6 h6 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 p @ 0 0 x @ 0 0 @ 0 x @ 0 @ 0 @ 0 x @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 x @ 0 @ 0 x @ 0 x @ 0 x @ 0 x @ 0 @ 0 x @ 0 @ 0 x @ 0 ( @ 0 @ 0 x @ 0 x @ 0 x @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 x @ 0 0 x @ 0 0 h @ 0 x @ 0 x @ 0 @ 0 x @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 x @ 0 x @ 0 @ 0 @ 0 @ 0 x @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 x @ 0 x @ 0 x @ 0 x @ 0 x @ 0 x @ 0 @ 0 x @ 0 x @ 0 @ 0 x @ 0 x @ 0 @ 0 x @ 0 x @ 0 @ 0 @ 0 @ 0 x @ 0 x @ 0 x @ 0 x @ 0 x @ 0 x @ 0 @ 0 x @ 0 x @ 0 @ 0 x @ 0 x @ 0 @ 0 x @ 0 x @ 0 @ 0 @ 0 x @ 0 x @ 0 x @ 0 x @ 0 x @ 0 @ 0 @ 0 x @ 0 x @ 0 x @ 0 @ 0 @ 0 @ 0 @ 0 x @ 0 @ 0 x @ 0 x @ 0 x @ 0 x @ 0 x @ 0 x @ 0 @ 0 x @ 0 x @ 0 @ 0 x @ 0 x @ 0 @ 0 x @ 0 x @ 0 ( @ 0 x @ 0 x @ 0 x @ 0 x @ 0 x @ 0 x @ 0 @ 0 x @ 0 x @ 0 x @ 0 x @ 0 @ 0 x @ 0 @ 0 @ 0 @ 0 x @ 0 P @ 0 P @ 0 P @ 0 P @ 0 P @ 0 P @ 0 P @ 0 P @ 0 T @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 @ 0 0 4٢ P ? k 3 I "5 `! ^L Q U U U [ [ \ \ qd _e e 9f f ;g h h t t qw L / C j ( H 4 ? A _ | X k0 Tm Um ˗ ' . && 8& V' ( * . . 8/ 9/ / / / / T0 U0 0 0 g1 m1 n1 1 1 2 2 /2 I2 d2 e2 q2 2 2 2 2 2 2 2 2 2 3 3 )3 *3 P3 Y3 Z3 e3 f3 g3 3 3 3 3 3 3 3 3 4
4 34 E4 W4 g4 h4 4 4 4 4 4 5 -5 <5 H5 I5 5 5 5 5 5 5 6 h6 0 0 0 0 0 0 0 0 0 0 0 0 @ 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 {@0"0 x <{@0"0 {@0"0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 h
U
@ 0 0!0 0*0 !0*0 0*0 0"0 @ 0 0*0 {@080 x l>{@080 {@0-0 {@0-0 {@0-0 @ 0 0"0 h
U@ 0 020 !020 020 0&0 |0 0 ` @0@0 @0@0 @0@0 0&0 030 030 050 070 {@090 {@0:0 y@0:0 0&0 }|0L0 0&0 y@0>0 }|0N0 0B0 0B0 0&0 ^~00 ^~00 ^~00 @ 0 R |0G0 |0G0 ^~00
@ 0 ^~00
^~00
^~00
^~00
^~00
^~0
0
^~0
0
^~00
^~00
B^~00
^~00
0=0 h
0=0 h
U^~00 @ 0 @ 0 050 0D0 0D0 0D0 0D0 0D0 0D0 0F0 0C0 0C0 0C0 0D0 0O0 0K0 0K0 0K0 0D0 0S0 0S0 0S0 0D0 0X0 )0X0 050 0D0 0D0 0L0 0L0 0K0 0K0 0K0 050 0l0 0l0 0l0 0l0 050 0q0 0q0 0q0 0q0 050 0Q0 0C0 0C0 0C0 050 0V0 0S0 0S0 0S0 050 00 00 00 00 00 050 @ 0 @ 0 R 3 > K K K K K K K K K N
& Q
; Y "q ҋ v T " * \T [ ^ nf o G} Y - 9 c l \ J g I: _ g W A ~ Ͼ ? 1 = ! 1 > 6 +
<
I
] + > R g @ * @ % z * <
4 4 <
: % = Q X
B O : D' ' ) / / / 5 5 6 ? ? ? CK pK K hQ ~Q R ,W @W W ?] R] ] Wb nb b Rh gh i "n Gn n r r Ns z { e{ T i X ʇ % ړ # x v + Q ۳ T ݸ 4 ǽ , ) o d l
! #& 8& w& a+ {+ + S6 6 6 ? !@ |@ 7F PF aG +L [L M Q 3Q ] Vc jc }k o o Xp at wt /z gz z z & ] ӌ u 6 F ) ƭ > , V 8 s n 4 } V h O J# d# # ^+ + + Q0 g0 1 8 8 9 ? ? ? N N O 0U GU U b b 2c j j uj 9m Qm n y y z~ A ϋ
= ֖ Ȝ & 5 % Ҥ # ! = S
D ^ n $ + e ! $& g6 XQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQXQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ#3 : > E G N ! ! 8 @ 0 (
B
S ? O L E _ L I N K 2 O L E _ L I N K 1 Q F h6 R h6 L -U ̈" .U $" /U
" 0U D" 1U 2U " 3U q# 4U ll 5U 4k 6U " 7U " 8U " 9U :U $j ;U d# U t ?U T @U AU BU l CU l DU $ EU $ FU l GU T HU T IU JU n KU n LU Dn MU 4m NU d# OU e# PU k QU k RU dj SU j TU \t# UU Ds# VU q# WU ,r# XU p# YU @ B A C E D F H G I J K u U V V cV sV sV W W W X X qX zX zX Z Z Z Z 9[ B[ B[ d[ h[ m[ m[ [ [ [ [ [ 1\ =\ =\ I\ S\ S\ t t v v v v : > C C ; ? D D ʙ Ι Ι d m m h6
! # " $ & % ' ) ( * + , . / - 0 2 3 1 4 6 5 7 8 9 ; < : = ? > @ B A C E D F H G I J K > L *urn:schemas-microsoft-com:office:smarttags
PersonName 8 G *urn:schemas-microsoft-com:office:smarttagsCity B F *urn:schemas-microsoft-com:office:smarttagscountry-region 9 K *urn:schemas-microsoft-com:office:smarttagsplace 8 *urn:schemas-microsoft-com:office:smarttagstime 9 5 *urn:schemas-microsoft-com:office:smarttagsState = J *urn:schemas-microsoft-com:office:smarttags PlaceType = I *urn:schemas-microsoft-com:office:smarttags PlaceName 110HourMinuteL K J I K G F K G F K G F K G F K F K G F K G 5 F K G F K G 5 F L L K G F K J I K J I K F K G 5 F K G 5 F K G 5 K F K G 5 F K G F K G F K G F K G F L u _ e w z > k u } 2 x { \ j N \
U h i l F' O' ]' f' t' }' ' ' J( T( Y( b( ) ) / / / / ? ? IK OK jQ qQ R R R R .W 3W SW bW ] ] b b h h li i i i $n 7n C K 4 ? 4 > l x ݳ ߸
5 8
/ 8
j! m! %& +& M& W& + + U6 [6 l6 s6 6 6 ? ? @ @ @ @ 9F @F iF zF F F F F F F F G -L 3L AL JL OL UL L L M M M M 'M 5M >M LM VM ^M M M Q &Q `Q cQ Q Q Q Q 'S *S nT qT pU sU V V BV JV V V )W 6W PW _W X
X cX iX X X X X Y Y $Y 'Y (Y 5Y vY Y Y Y Y Y Y Y mZ pZ Z Z Z Z 1[ 9[ T[ Y[ [ [ [ [ \ \ "] 0] <] >] c c d d d d d d e e f f ,h .h h h pi si =j @j ct jt t t t t u u Mv Uv gv mv x x x x x x x x xy }y y y y y z %z
& , Ռ ی č % ' - g p 1 ? Ñ Ǒ Ց ב ؑ ܑ R Z ( 6 ߖ ޗ T Z ʘ Ҙ = C Й ֙ $ & 1 3 C R ) Z d Y ^ t v ʜ ќ I K \ ^ u } 4 6 7 ; D F G K ^ c ئ ۦ ѧ ԧ
% ' մ ܴ . < ѽ ߽ S Y s 8 F E H i l G J # e s ) , : = > K g i y | } g j i l A I r | X b : B S# W# `+ h+ m+ s+ z+ + S0 Z0 ? ? N N VO aO 5U :U b b c c *j -j xm {m n n y y Cz Fz z z { { { { | | | | } } ,~ 7~ Ç Ї " / Ö Ȗ Ж ڗ ݗ p D G r ѩ 2 B # + 0 7 ڶ
C I ٽ F Q [ n " ( ? F h t 0 8 v y Y \ h z u ~ + 4 D G r x W `
$ , 8 J g r ] h 3 9 p v
! ! & 3 4 ? d l t z
" * 0 C J # $ + , / 0 6 G O Z a / 4 % * / 6 ; I Q U Z b g l t } % - E N V ^ f k v z
% / G O T Z b k ^ f 8 B C F [ _ g m W c q x } Q Y Z ] k r z " ) G L T [ H P Q X # * * . 6 < K Q
$ 6 < Q d } + [ _ ` d w ~ % + 9 ` d e i p v N R c j * / 0 8 T [ f k 9 ? D L Q X i x } & , Z g % 0 : E f n { < ? M X
< K c v
h
t
" * + / K R ] d / = > I b f g k
N
Z
r
|
% - . 6 H O W ] b i ' / ] h : A F R d j ( . D L T \ 2 8 H P F R T ] ^ a m v ~
% ) J R ] j 3 ; g m r w ] a b f g j + 1 6 ; @ G O X
` i s w x | v * 2 c m s ; L d s "! )! K! W! _! e! j! p! u! z! ! ! ! ! -" 1" L" Q" V" ^" s" }" " #
# # ~# # # # # # # # # $ 1$ ;$ r$ t$ $ $ $ $ $ $ % % % )% e% i% j% n% % % % % & & & & ' %' ' ' X( `( ( ( ( (
) ) ) ) 6) 9) O) R) S) `) ) ) ) ) [* ^* * * * * - - Q- T- - - - - - - - - . . . . . . . / ,/ // R/ X/ Y/ c/ / / / / / / / / 0 0 0 "0 H0 K0 p0 }0 ~0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 :1 ;1 P1 Q1 f1 }1 1 !2 )2 <2 D2 W2 _2 g3 i3 l3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 4
4 4 4 !4 "4 )4 +4 14 34 84 E4 J4 W4 \4 y4 4 4 4 4 4 4 4 %5 (5 _5 d5 5 5 5 5 6 6 6 &6 H6 J6 K6 L6 M6 U6 X6 b6 e6 h6 R \ > V V V V W W W
$ Z ; o p ! ! $ %$ & U' 4( ( &* z* * * g3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 4
4 )4 *4 24 34 D4 E4 V4 W4 f4 6 6 M6 U6 X6 b6 e6 h6 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 > ? ) / % ( U U [ [ kw qw P } ] { 6 Q C e ` G c " > ` ~
[ ; = Z X & 8& '. 1 2 3 3
4 *4 h4 4 4 5 I5 5 5 6 6 (6 e6 h6 6 6 e6 h6 M e l i t a S a l k o v i c z t
0 E j k{ e! < l\ h B e
1+ H N
7-
GW
ZW
Y Z f ? gb _ c m t s6 8 b O & ? O uz ] E
7 o & } a M T} NJ \ q : Y d ! L! " 2" {" O# U# z# -$ _>$ m$ <% O% \% }% N & '>' c.( ?( Q( pb( o( )( m+
+ 9+ 5_+ %- =- r- Bu- }?. ,/ cM/ ]/ 0 70 aT1 u1 13
^3 P5 Qb6 k6 jL7 8 08 J8 -9 Q9 [Y9 f9 -: L: M; D; d; n; Eh< > ?#> ^Q> Q? ]P@ *A B 9C "kC ^D J F &F tF %G ]
^ X^ \^ 5_ [_ K` (a Ha va |b ~b Zsc Jd Te Noe Tf Dxf Yg ag Jlg ci vi k Ok g'l (l Cl m Snm )n cn ?un X
o go KVp \q q 6Zq |q Hr Tr \r
s t%s t I/t iAt Tt Eu U v #v (nv w !1w Hx 6z { 2{ ~{ S-| /#} )} ^} 3h} ~ "~ C~ u~ L N 5 >$ 6 f 4b H C uR ro # X ~ E3 w # L . > -I Z oJ X Ve % /D S tM ? [7 g 2 f 5
L ` ~ YX Y
g
_- 2 _ ck = ;8 F d b# pP _ o5 \ _ e r Y 9v ~ M z! V) 8 \ d
* 0 g1 J u g * yM z -4 = c ? X n C t \ 8
|
+ - wV d{ B {1 9 Z
" f v ' ]t 9= H h5 62 So Bx 9 - < gT t S > I ) @ 6w @ x vf 2 I v T ]Y 4 i ;6 ) . W +m { `| H X d `y , 7 K N % j2 0v I R
. 5O 3 C N /C # $ l> ! P`
S/ } 2 ~ N ~' P [" i r k v
* ?x 3 s5 S | s J] \ 1- # AG f 5 2? %l = bo WF >T m %& sz @ ;U N "c / o + J H [ b 5 : : Hn P g 5 4g U. Z. f. t. . . . . . . . . . (/ ,/ 1/ 5/ 8/ 9/ C/ H/ R/ / / / / / / / / / / / / / / / 0
0 0 D0 H0 M0 Q0 T0 U0 ~0 0 0 0 0 0 0 0 0 0 0 1 1 ;1 g1 j1 m1 n1 2 2 /2 I2 d2 e2 q2 2 2 2 2 2 2 2 2 2 2 3 3 )3 *3 >3 G3 P3 Y3 Z3 e3 f3 g3 3 3 3 3 3 3 3 3 4
4 34 E4 W4 g4 h4 4 4 4 4 4 5 -5 <5 H5 I5 5 5 5 5 5 h6 E N . I n s t a n t F o r m a t E N . L a y o u t E N . L i b r a r i e s w < E N I n s t a n t F o r m a t > < E n a b l e d > 0 < / E n a b l e d > < S c a n U n f o r m a t t e d > 1 < / S c a n U n f o r m a t t e d > < S c a n C h a n g e s > 1 < / S c a n C h a n g e s > < / E N I n s t a n t F o r m a t > W< E N L a y o u t > < S t y l e > J N e u r o c h e m < / S t y l e > < L e f t D e l i m > { < / L e f t D e l i m > < R i g h t D e l i m > } < / R i g h t D e l i m > < F o n t N a m e > T i m e s N e w R o m a n < / F o n t N a m e > < F o n t S i z e > 1 2 < / F o n t S i z e > < R e f l i s t T i t l e > < / R e f l i s t T i t l e > < S t a r t i n g R e f n u m > 1 < / S t a r t i n g R e f n u m > < F i r s t L i n e I n d e n t > 0 < / F i r s t L i n e I n d e n t > < H a n g i n g I n d e n t > 7 2 0 < / H a n g i n g I n d e n t > < L i n e S p a c i n g > 0 < / L i n e S p a c i n g > < S p a c e A f t e r > 0 < / S p a c e A f t e r > < / E N L a y o u t > G < E N L i b r a r i e s > < L i b r a r i e s > < i t e m > E d n a . e n l < / i t e m > < / L i b r a r i e s > < / E N L i b r a r i e s > @ < NW NX c d h i : : : : : : : : : D D C' C- C. 1 2 3 g6 P @ P ` P @ P n P @ P t P @ P P L@ P P X@ P P P d@ P P @ P P @ P P @ P @ P P @ P P @ P U n k n o w n G z T i m e s N e w R o m a n 5 S y m b o l 3& z A r i a l ; W i n g d i n g s c T i m e s N e w R o m a n T i m e s N e w R o m a n " 1 h :{:{Z& z g z g ! 4 d v4 v4 2q H ? / O R I G I N A L A R T I C L E L i n d a M e l i t a S a l k o v i c Oh +'0 $
@ L X
d p x ORIGINAL ARTICLE d RIG Linda AL ind ind Normal L Melita Salkovic 2 li Microsoft Word 10.0 @ F# @ H@ -f@ -f z g ՜. +,D ՜. +,@ h p
Home i v4 {
ORIGINAL ARTICLE Title P @ H ` _PID_HLINKS _AdHocReviewCycleID _EmailSubject
_AuthorEmail _AuthorEmailDisplayName _PreviousAdHocReviewCycleID _ReviewingToolsShownOnce A
) h t t p : / / m e d g e n . u g e n t . b e / ~ j v d e s o m p / g e n o r m / d - m a i l t o : e d n a . g r u e n b l a t t @ m a i l . u n i - w u e r z b u r g . d e o@J Very Urgent!! sS & edna.gruenblatt@mail.uni-wuerzburg.de e Edna Grnblatt @ QO dna
! " # $ % & ' ( ) * + , - . / 0 1 2 3 4 5 6 7 8 9 : ; < = > ? @ A B C D E F G H I J K L M N O P Q R S T U V W X Y Z [ \ ] ^ _ ` a b c d e f g h i j k l m n o p q r s t u v w x y z { | } ~
! " # $ % & ' ( ) * + , - . / 0 1 2 3 4 5 6 7 8 9 : ; < = > ? @ A B C D E F G H I J K L M N O P Q R S T U V W X Y Z [ \ ] ^ _ ` a b c d e f g h i j k l m n o p q r s t u v w x y z { | } ~
! " # $ % & ' ( ) * + , - . / 0 1 2 3 4 5 6 7 8 9 : ; < = > ? @ A B C D E F G H I J K L M N O P Q R S T U V W X Y Z [ \ ] ^ _ ` a b c d e f g h i j k l n o p q r s t v w x y z { | R o o t E n t r y F 3Nf D a t a
1 T a b l e W W o r d D o c u m e n t y" S u m m a r y I n f o r m a t i o n ( m D o c u m e n t S u m m a r y I n f o r m a t i o n 8 u C o m p O b j j
F Microsoft Word Document
MSWordDoc Word.Document.8 9q