Naslov
Status of the DPC4 tumor suppressor gene in sporadic colon adenocarcinoma of croatian patients: identification of a novel somatic mutation

Autori
Popović Hadžija, Marijana ; Radoševic, Senka ; Kovačević, Duje ; Lukač, Josip ; Hadžija, Mirko ; Spaventi, Radan ; Pavelić, Krešimir ; Kapitanović, Sanja

Izvornik
Mutation research (0027-5107) 548 (2004); 61-73

Vrsta, podvrsta i kategorija rada
Radovi u časopisima, članak, znanstveni

Ključne riječi
DPC4; Loss of heterozygosity; tumor suppressor gene; colon adenocarcinoma

Sažetak
Loss of heterozygosity (LOH) of loci on chromosome 18q occurs in a majority of colorectal cancers. The DPC4 (Smad4) tumor-suppressor gene, located at 18q21.1, may be predisposing gene for Juvenile Polyposis Syndrome (JPS). To investigate the alterations of the DPC4 gene in sporadic colon adenocarcinoma, a panel of 60 tumor specimens of Croatian patients was surveyed for evidence of LOH at 18q21 and also for mutations within the mad homology (MH) domains 1 (exons 2) and 2 (exons 8, 10, 11). Using three pairs of specific primers for the three DPC4 microsatellite repetitive sequences, we investigated LOH. The presence of mutations in the tested exons was examined by specific RFLP analysis. The investigation was extended to a search for other mutations in four selected exons by single strand conformation polymorphism (SSCP) analysis. Our results show a high frequency of heterozygosity - in fifty-eight of sixty (97%) collected colon adenocarcinoma tumors. The loss of heterozygosity at any of three flanking markers was observed in 26 (45%) of the 59 informative cases. The loss of one allele of the DPC4 gene was negatively correlated with tumor size ; more frequent in smaller tumors (<5 cm) than in larger ones. We found a mutation in one of the tumor sample (T18) in exon 11, and the mutation was verified by sequencing. Sequencing demonstrated a novel mutation - a deletion in exon 11 (134-153 del TAGACGAAGTACTTCATACC) of the DPC4 gene in the MH2 domain. These data suggest that inactivation of the DPC4 gene contributes to the genesis of colorectal carcinoma.

Izvorni jezik
Engleski

Znanstvena područja
Temeljne medicinske znanosti, Kliničke medicinske znanosti

POVEZANOST RADA