Napredna pretraga

Pregled bibliografske jedinice broj: 831214

Molecular identification of Paramphistomum leydeni and Paramphistomum cervi in red deer (Cervus elaphus) in Croatia

Sindičić, Magda; Špehar, Marina; Strišković, Tanja; Štimac, Iva; Bujanić, Miljenko; Martinković, Franjo; Živičnjak, Tatjana; Konjević, Dean
Molecular identification of Paramphistomum leydeni and Paramphistomum cervi in red deer (Cervus elaphus) in Croatia // Contributions to the 12th Conference of the European Wildlife Disease Association (EWDA) / Schumann, Anke ; Wibbelt, Gudrum ; Greenwood, Alex D. ; Hofer, Heribert (ur.).
Berlin, Germany: Leibniz Institute for Zoo and Wildlife Reserch, 2016. str. 194-194 (poster, međunarodna recenzija, sažetak, znanstveni)

Molecular identification of Paramphistomum leydeni and Paramphistomum cervi in red deer (Cervus elaphus) in Croatia

Sindičić, Magda ; Špehar, Marina ; Strišković, Tanja ; Štimac, Iva ; Bujanić, Miljenko ; Martinković, Franjo ; Živičnjak, Tatjana ; Konjević, Dean

Vrsta, podvrsta i kategorija rada
Sažeci sa skupova, sažetak, znanstveni

Contributions to the 12th Conference of the European Wildlife Disease Association (EWDA) / Schumann, Anke ; Wibbelt, Gudrum ; Greenwood, Alex D. ; Hofer, Heribert - Berlin, Germany : Leibniz Institute for Zoo and Wildlife Reserch, 2016, 194-194


12th Conference of the European Wildlife Disease Association

Mjesto i datum
Berlin, Njemačka, 27-31.08.2016.

Vrsta sudjelovanja

Vrsta recenzije
Međunarodna recenzija

Ključne riječi
Paramphistomosis ; Paramphistomum leydeni ; Paramphistomum cervi ; ITS2 ; red deer ; Cervus elaphus

Paramphistomosis of domestic and wild ruminants is caused by rumi-nal flukes from Paramphistomum genus (Trematoda: Digenea) that parasitize in fore stomachs as adults and in intestines as juveniles, and may cause major economic losses. Given their worldwide distribution and indications that in-fections are becoming more common it seems that the importance of these parasites is underestimated. Even though it was considered that Paramphisto-mum flukes are present in Croatia, scientific data are rare. So far there is one report of Paramphistomum cervi and P. microbothrium in roe and red deer from 1966, and finding from 1990 that assumes P. cervi presence in red deer. In domestic animals the infection was registered only in 2006 and 2010 in sheep and cattle, but the identification of fluke species was not performed. The goal of our work was to identify the species of ruminal flukes which were found in one red deer (Cervus elaphus) in Croatia. Research was conducted on 23 samples of flukes found in the rumen of a hunted doe. Considering the fact that differentiation of Paramphistomum species based on morphological characteristics is insufficient, we performed the molecular analysis of ITS2 region of ribosomal DNA. A total of 320 base pairs of ITS2 region was ampli-fied using primers GA1 (AGAACATCGACATCTTGAAC) (Anderson and Barker, 1998) and BD2 (TATGCTTAAATTCAGCGGGT) (Luton et al., 1992) and sequenced. We have determined that 22 samples were identical with Paramphistomum leydeni sequences from China, Uruguay and Ireland depos-ited in the GenBank, while one sample concurred with the Paramphistomum cervi sequence from China. This is the first report of P. leydeni in Croatia and first molecular confirmation of P. cervi presence. Our results do not exclude the presence of other Paramphistomum species in Croatia and considering the rising importance of these parasites it would be important to conduct a sys-tematic research of distribution and prevalence of paramphistomosis both in wild and domestic ruminants.

Izvorni jezik

Znanstvena područja
Veterinarska medicina


Projekt / tema
HRZZ-UIP-2013-11-3421 - Molekularna epidemiologija nekih invazijskih oboljenja divljih životinja (Dean Konjević, )

Veterinarski fakultet, Zagreb