engleski

First evidence of Rickettsia helvetica in dermacentor ticks in northern Croatia

Aim: To study whether Dermacentor spp. ticks in the continental part of Croatia, in the region suspected to have circulating spotted fever group (SFG) rickettsiae, are infected by Rickettsia helvetica, and to investigate by molecular methods whether Dermacentor reticulatus is present beside Dermacentor marginatus in Croatia as well. Methods: One hundred Dermacentor spp. ticks were collected in the north-west part of Croatia. The ITS2 spacer region of the rRNA operon which varies in amplification length and sequence according to species was used for identification of the Dermacentor species collected in Croatia. Primers ITSf (5' - GTGCGTCCGTCGACTCGTTTT GA - 3') and ITSr 5' – (ACGGCGGACTACGACGGAA - 3') targeting the conserved regions of the ITS2 spacer sequences of Dermacentor species were used for amplification. Specific primer sequences and TaqMan probes were designed, based on flaB gene for Borrelia burgdorferi s.s., p66 gene for Borrelia afzelii and Borrelia garinii, ompB gene for R. helvetica and msp4 gene for Anaplasma phagocytophilum using the Primer Express software program (Applied Biosystems). Results: In consideration of the intra-specific polymorphisms in the partial ITS2 spacer region of Dermacentor reticulatus ticks of Croatia, the sequences are identical to the published ITS2 sequence of D. reticulatus and are 84% homolog to the ITS2 spacer sequence with differences regarding deleted and inserted base pairs of Dermacentor marginatus. Of one hundred ticks 17 (17%) were positive for R. helvetica DNA, and none was positive for B. burgdorferi and Anaplasma phagocytophilum. Rickettsia helvetica DNA was found 4 out of 25 (16%) nymphs, 8 out of 33 (24%) adult male ticks and 5 out of 42 (12%) adult females. Conclusion: To the best of our knowledge, this is the first report of R. helvetica in Croatia and the first molecular evidence on the existence of Dermacentor reticulatus tick in Croatia. Further investigations on the distribution of R. helvetica in other ticks, as Ixodes ricinus and in humans should be conducted.

Dermacentor reticulatus; Rickettsia helvetica

nije evidentirano